ID: 1063489264

View in Genome Browser
Species Human (GRCh38)
Location 10:6448036-6448058
Sequence GGATTTTTCCAGGTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063489259_1063489264 -10 Left 1063489259 10:6448023-6448045 CCGACCAGGGGTGGGATTTTTCC 0: 1
1: 0
2: 0
3: 20
4: 161
Right 1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG No data
1063489252_1063489264 16 Left 1063489252 10:6447997-6448019 CCAAGTGGATGGTGGGAGGGCAG 0: 1
1: 0
2: 1
3: 30
4: 327
Right 1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG No data
1063489258_1063489264 -7 Left 1063489258 10:6448020-6448042 CCTCCGACCAGGGGTGGGATTTT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063489264 Original CRISPR GGATTTTTCCAGGTGGAGTA GGG Intronic
No off target data available for this crispr