ID: 1063494815

View in Genome Browser
Species Human (GRCh38)
Location 10:6497207-6497229
Sequence CAGTGCCGACGTAAGTAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063494815_1063494818 -4 Left 1063494815 10:6497207-6497229 CCCTCTTACTTACGTCGGCACTG 0: 1
1: 0
2: 0
3: 6
4: 32
Right 1063494818 10:6497226-6497248 ACTGGTAGCCCTGTTTGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063494815 Original CRISPR CAGTGCCGACGTAAGTAAGA GGG (reversed) Exonic
901278890 1:8016040-8016062 CAGTGCAGCCGTAACTTAGAAGG - Intronic
909859486 1:80587138-80587160 CAGTGCCTAAGTGAGCAAGAAGG - Intergenic
924102007 1:240613467-240613489 ATGTGCCCACGTAAGAAAGAAGG - Intergenic
1063494815 10:6497207-6497229 CAGTGCCGACGTAAGTAAGAGGG - Exonic
1072780904 10:98251097-98251119 CAGTGCCGCTGCAAGTATGATGG - Exonic
1073592620 10:104771347-104771369 CAGTGCTGATGTGAGAAAGATGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1099248514 12:80222828-80222850 CAGCCCCAACGTAAGTAAAAAGG - Intronic
1100689738 12:97027150-97027172 CAGTGCTGCCCTAAGTAAGTTGG + Intergenic
1107948407 13:45440547-45440569 CAGTGCCAACATAAGCACGAGGG - Intergenic
1113902720 13:113805615-113805637 CAGTGCCGAGGTAAGAAACGTGG - Intronic
1128440144 15:67699315-67699337 CAGGGCCCACCTAAGTCAGAAGG + Intronic
1131537223 15:93247600-93247622 AAATGCCGACCTAAGTAACACGG + Intergenic
1134802289 16:17096411-17096433 CAGTGCCCACGTTCATAAGAAGG - Intergenic
1145297891 17:21608757-21608779 CAGTGCCAAATTAAGTAAGATGG + Intergenic
1145352367 17:22094641-22094663 CAGTGCCAAATTAAGTAAGATGG - Intergenic
1149697641 17:58628945-58628967 CAGAGCCTCCTTAAGTAAGATGG + Intronic
1159384259 18:67702479-67702501 CAGTGCAGATTTAGGTAAGATGG + Intergenic
1161391477 19:4023525-4023547 CAGTCCAGTTGTAAGTAAGAGGG + Intronic
1164940945 19:32251940-32251962 CAGTGCCGACATCAGCAGGAGGG + Intergenic
1181543604 22:23587848-23587870 CAGTGCAGACGCAATTAAGGTGG - Intergenic
950620870 3:14204252-14204274 CAGTGCCCACCTCAGGAAGAAGG + Intergenic
951705852 3:25543631-25543653 CAGCGCTGACCTAAGTGAGATGG + Intronic
955870201 3:63430497-63430519 CAGTGTGGAAGTACGTAAGATGG + Intronic
971999071 4:34006463-34006485 CAGTGCCAAATTAAGTAAGATGG + Intergenic
995610237 5:113901904-113901926 CAGTGCTGACGTCACTGAGAAGG + Intergenic
996172944 5:120317730-120317752 CAGTAGAGACGTAAGTAACATGG + Intergenic
999242336 5:150135203-150135225 CAGTGCCAGGGTAAGAAAGAAGG + Intronic
1009518590 6:64653036-64653058 CTTTGCCGATGAAAGTAAGATGG + Intronic
1013880878 6:114899100-114899122 CAATAACGATGTAAGTAAGAAGG + Intergenic
1017722146 6:157251154-157251176 CAGTGCAGAAGGAAGTAAGTTGG - Intergenic
1025275109 7:57575484-57575506 CAGTGCCAAATTAAGTAAGATGG + Intergenic
1039571932 8:38593587-38593609 CAGAGCCTACCCAAGTAAGAAGG + Intergenic
1040397900 8:47016893-47016915 CAGTGGCGATGTCAGCAAGATGG - Intergenic
1051039591 9:12791137-12791159 CAGTGTTCACATAAGTAAGATGG + Intronic
1060034423 9:120242708-120242730 CTGTGCCGAGTTAATTAAGAGGG + Intergenic
1203626375 Un_KI270750v1:29306-29328 CAGTGCCAAATTAAGTAAGATGG + Intergenic
1193591899 X:83398910-83398932 CAGAGCAGAACTAAGTAAGATGG + Intergenic
1196605128 X:117648320-117648342 CAGTGAAGACTTAAGCAAGAGGG - Intergenic