ID: 1063497716

View in Genome Browser
Species Human (GRCh38)
Location 10:6525767-6525789
Sequence CTTTGAGGGGGATCTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063497711_1063497716 -10 Left 1063497711 10:6525754-6525776 CCCAGGTTGGTTTCTTTGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 280
Right 1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG No data
1063497706_1063497716 7 Left 1063497706 10:6525737-6525759 CCACACAGAGGGTCATTCCCAGG No data
Right 1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG No data
1063497701_1063497716 26 Left 1063497701 10:6525718-6525740 CCTCTTTCCTCCTTGATCTCCAC 0: 1
1: 0
2: 2
3: 54
4: 581
Right 1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG No data
1063497702_1063497716 19 Left 1063497702 10:6525725-6525747 CCTCCTTGATCTCCACACAGAGG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG No data
1063497705_1063497716 16 Left 1063497705 10:6525728-6525750 CCTTGATCTCCACACAGAGGGTC 0: 1
1: 0
2: 0
3: 12
4: 180
Right 1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063497716 Original CRISPR CTTTGAGGGGGATCTGCTGG AGG Intronic
No off target data available for this crispr