ID: 1063498353

View in Genome Browser
Species Human (GRCh38)
Location 10:6530548-6530570
Sequence GGGGGGGTTGTTGCAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063498345_1063498353 11 Left 1063498345 10:6530514-6530536 CCCGGCAACGGGGGACTGGGCTA 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG No data
1063498335_1063498353 30 Left 1063498335 10:6530495-6530517 CCCGCATGTGCCGGCTCTGCCCG 0: 1
1: 0
2: 0
3: 17
4: 119
Right 1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG No data
1063498341_1063498353 20 Left 1063498341 10:6530505-6530527 CCGGCTCTGCCCGGCAACGGGGG 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG No data
1063498336_1063498353 29 Left 1063498336 10:6530496-6530518 CCGCATGTGCCGGCTCTGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG No data
1063498346_1063498353 10 Left 1063498346 10:6530515-6530537 CCGGCAACGGGGGACTGGGCTAT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1063498353 10:6530548-6530570 GGGGGGGTTGTTGCAAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063498353 Original CRISPR GGGGGGGTTGTTGCAAATAG AGG Intronic
No off target data available for this crispr