ID: 1063501609

View in Genome Browser
Species Human (GRCh38)
Location 10:6560175-6560197
Sequence TAAGCCACCCTAATGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063501602_1063501609 18 Left 1063501602 10:6560134-6560156 CCCTTCTCCTTGAAAATATCCAT 0: 1
1: 0
2: 2
3: 31
4: 387
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data
1063501603_1063501609 17 Left 1063501603 10:6560135-6560157 CCTTCTCCTTGAAAATATCCATT 0: 1
1: 0
2: 3
3: 21
4: 395
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data
1063501604_1063501609 11 Left 1063501604 10:6560141-6560163 CCTTGAAAATATCCATTTTCTCT 0: 1
1: 0
2: 7
3: 164
4: 1511
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data
1063501601_1063501609 19 Left 1063501601 10:6560133-6560155 CCCCTTCTCCTTGAAAATATCCA 0: 1
1: 0
2: 1
3: 32
4: 336
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data
1063501605_1063501609 -1 Left 1063501605 10:6560153-6560175 CCATTTTCTCTTTGTTACTGCCT 0: 1
1: 0
2: 4
3: 86
4: 902
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data
1063501599_1063501609 28 Left 1063501599 10:6560124-6560146 CCCAGCTTTCCCCTTCTCCTTGA 0: 1
1: 0
2: 1
3: 40
4: 439
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data
1063501600_1063501609 27 Left 1063501600 10:6560125-6560147 CCAGCTTTCCCCTTCTCCTTGAA 0: 1
1: 0
2: 2
3: 48
4: 532
Right 1063501609 10:6560175-6560197 TAAGCCACCCTAATGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063501609 Original CRISPR TAAGCCACCCTAATGGGTGA AGG Intronic
No off target data available for this crispr