ID: 1063504013

View in Genome Browser
Species Human (GRCh38)
Location 10:6580170-6580192
Sequence CGCCGCCGCCGGGAGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4805
Summary {0: 1, 1: 1, 2: 11, 3: 85, 4: 4707}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063504013_1063504030 26 Left 1063504013 10:6580170-6580192 CCCGCTCCCTCCCGGCGGCGGCG 0: 1
1: 1
2: 11
3: 85
4: 4707
Right 1063504030 10:6580219-6580241 AGCACGGCGCCGCTGCTGCCCGG 0: 1
1: 0
2: 0
3: 18
4: 166
1063504013_1063504025 -1 Left 1063504013 10:6580170-6580192 CCCGCTCCCTCCCGGCGGCGGCG 0: 1
1: 1
2: 11
3: 85
4: 4707
Right 1063504025 10:6580192-6580214 GCGGGGCGCGGGGCCCTACCTGG 0: 1
1: 0
2: 4
3: 23
4: 233
1063504013_1063504026 10 Left 1063504013 10:6580170-6580192 CCCGCTCCCTCCCGGCGGCGGCG 0: 1
1: 1
2: 11
3: 85
4: 4707
Right 1063504026 10:6580203-6580225 GGCCCTACCTGGAGCGAGCACGG 0: 1
1: 0
2: 1
3: 4
4: 106
1063504013_1063504031 29 Left 1063504013 10:6580170-6580192 CCCGCTCCCTCCCGGCGGCGGCG 0: 1
1: 1
2: 11
3: 85
4: 4707
Right 1063504031 10:6580222-6580244 ACGGCGCCGCTGCTGCCCGGTGG 0: 1
1: 1
2: 1
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063504013 Original CRISPR CGCCGCCGCCGGGAGGGAGC GGG (reversed) Intronic
Too many off-targets to display for this crispr