ID: 1063504036

View in Genome Browser
Species Human (GRCh38)
Location 10:6580238-6580260
Sequence CCGCGCAGTCCCAGCGCCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063504036_1063504045 1 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504045 10:6580262-6580284 GACTGCGCGGGGACTGCGCGGGG 0: 2
1: 0
2: 1
3: 6
4: 110
1063504036_1063504052 19 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504052 10:6580280-6580302 CGGGGACTGGCGGGGCTGGCGGG 0: 1
1: 0
2: 3
3: 105
4: 743
1063504036_1063504054 24 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504054 10:6580285-6580307 ACTGGCGGGGCTGGCGGGGCTGG 0: 1
1: 8
2: 15
3: 103
4: 800
1063504036_1063504053 20 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504053 10:6580281-6580303 GGGGACTGGCGGGGCTGGCGGGG 0: 1
1: 0
2: 20
3: 73
4: 780
1063504036_1063504049 11 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504049 10:6580272-6580294 GGACTGCGCGGGGACTGGCGGGG 0: 1
1: 0
2: 1
3: 25
4: 213
1063504036_1063504047 9 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504047 10:6580270-6580292 GGGGACTGCGCGGGGACTGGCGG 0: 1
1: 1
2: 1
3: 34
4: 336
1063504036_1063504042 -10 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504042 10:6580251-6580273 GACTGCGCGGGGACTGCGCGGGG 0: 2
1: 0
2: 1
3: 6
4: 110
1063504036_1063504056 28 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504056 10:6580289-6580311 GCGGGGCTGGCGGGGCTGGCGGG 0: 8
1: 4
2: 68
3: 286
4: 2265
1063504036_1063504051 18 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504051 10:6580279-6580301 GCGGGGACTGGCGGGGCTGGCGG 0: 1
1: 2
2: 5
3: 121
4: 983
1063504036_1063504050 15 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504050 10:6580276-6580298 TGCGCGGGGACTGGCGGGGCTGG 0: 1
1: 0
2: 5
3: 46
4: 401
1063504036_1063504057 29 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504057 10:6580290-6580312 CGGGGCTGGCGGGGCTGGCGGGG 0: 8
1: 1
2: 36
3: 144
4: 1070
1063504036_1063504044 0 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504044 10:6580261-6580283 GGACTGCGCGGGGACTGCGCGGG 0: 2
1: 0
2: 0
3: 13
4: 158
1063504036_1063504046 6 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504046 10:6580267-6580289 CGCGGGGACTGCGCGGGGACTGG 0: 1
1: 0
2: 2
3: 28
4: 249
1063504036_1063504048 10 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504048 10:6580271-6580293 GGGACTGCGCGGGGACTGGCGGG 0: 1
1: 0
2: 4
3: 33
4: 257
1063504036_1063504043 -1 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504043 10:6580260-6580282 GGGACTGCGCGGGGACTGCGCGG 0: 2
1: 0
2: 1
3: 18
4: 247
1063504036_1063504055 27 Left 1063504036 10:6580238-6580260 CCGGTGGCGCTGGGACTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1063504055 10:6580288-6580310 GGCGGGGCTGGCGGGGCTGGCGG 0: 8
1: 4
2: 53
3: 355
4: 6438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063504036 Original CRISPR CCGCGCAGTCCCAGCGCCAC CGG (reversed) Exonic
901102027 1:6726389-6726411 CCACGCTGCCCCAGCCCCACAGG + Intergenic
903492897 1:23743288-23743310 CCGCGCACTCCTCGCGCCCCTGG - Exonic
905408477 1:37753157-37753179 CAGCGCAGTCGCAGCACCAGCGG + Exonic
912433718 1:109643792-109643814 CCGCGCTGGCCCAGCCCCGCAGG - Intergenic
921918394 1:220639677-220639699 CTGTGCAGTCCCATCCCCACTGG + Intronic
922180884 1:223231788-223231810 CCAGGCAGTCCCGGGGCCACTGG - Intronic
1063115118 10:3067473-3067495 CCGCCCGGCCCCAGCGCCAATGG - Intronic
1063504036 10:6580238-6580260 CCGCGCAGTCCCAGCGCCACCGG - Exonic
1069430537 10:68330976-68330998 CCGAGTAGTCCCAGCTACACAGG - Intronic
1071532550 10:86400904-86400926 CCCCGCAGTGCCGGCGCCTCTGG + Intergenic
1075514236 10:123096556-123096578 CCCGGCAGTCCCAGAGCCACTGG + Intergenic
1076360922 10:129888472-129888494 CCGCGGAGGCCCAGTCCCACTGG + Intronic
1076834942 10:133016345-133016367 CAGCCCAGGCCCAGAGCCACCGG + Intergenic
1077370383 11:2179127-2179149 CCCAGCAGTGCCAGTGCCACGGG + Intergenic
1083945156 11:65919349-65919371 CCGCGGAGTCCTAGCGCCGCCGG - Exonic
1084275530 11:68049341-68049363 CCCCGCGGTCACAGGGCCACTGG + Intronic
1084331799 11:68434773-68434795 CCTCGCTCTCCCAGAGCCACCGG + Intronic
1087045290 11:93839295-93839317 CCCAGCAGTCCCTGGGCCACGGG - Intronic
1091361708 11:134983193-134983215 CTGCACAGTCCCAGCGTCCCAGG + Intergenic
1092126521 12:6078651-6078673 CGGAGCAGTCCCTGCACCACAGG + Intronic
1095921229 12:47533119-47533141 CACCTCAGTCCCAGCACCACTGG + Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103521023 12:121537174-121537196 CCGCGCTGTCCCAGCCACCCTGG - Intronic
1103620343 12:122183451-122183473 CCGCGCAGTGCCCGCGACTCGGG - Intronic
1106410462 13:29507760-29507782 CCACGCAGTCTCAGATCCACTGG + Intergenic
1109429385 13:62212361-62212383 CAGGGCAGTCCCACCGCCAGGGG + Intergenic
1109908460 13:68876841-68876863 CCGTGTAGTCCCAGCGGCTCGGG - Intergenic
1111030536 13:82592047-82592069 CACCTCAGTCCCAGCACCACAGG - Intergenic
1121838160 14:97110242-97110264 CCCCGCAGTCCCAGCTACTCAGG - Intergenic
1126668266 15:51094151-51094173 CAGCGCAGTCCCGGCGCCCCAGG + Intronic
1126730904 15:51681485-51681507 GCGCGCAGTCTCCGCGTCACAGG + Exonic
1132656113 16:1042669-1042691 CCTCCCAGCTCCAGCGCCACCGG - Intergenic
1133220187 16:4316317-4316339 CCCCGCAGCCCCGGCGCGACAGG - Intronic
1136451151 16:30354988-30355010 CCCCGCAGTCTGCGCGCCACCGG + Intronic
1137253527 16:46757459-46757481 CTGCGCGGTCCCAGCACCAGAGG - Intronic
1142130730 16:88430482-88430504 CCGCGCAGACCCCGCGCCCCGGG + Exonic
1145293885 17:21573469-21573491 CGGCGCCGTGCCACCGCCACGGG + Intronic
1145378759 17:22375616-22375638 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145379235 17:22377986-22378008 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145379713 17:22380356-22380378 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145380192 17:22382731-22382753 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145380672 17:22385078-22385100 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145381150 17:22387453-22387475 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145381633 17:22389806-22389828 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145381752 17:22390499-22390521 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145381886 17:22391228-22391250 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145382359 17:22393592-22393614 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145383213 17:22397778-22397800 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145384164 17:22402448-22402470 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145385088 17:22406909-22406931 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145385271 17:22407981-22408003 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1145385719 17:22410339-22410361 CAGCGCCGTGCCACCGCCACGGG - Intergenic
1152710306 17:81867940-81867962 CCGTGCCGTCCCTGGGCCACTGG - Exonic
1153658743 18:7307863-7307885 CCACGCTGTCCCAGGGACACTGG + Intergenic
1160735044 19:658556-658578 CCCCGCAGCCCCAGAGGCACGGG + Intronic
1160873059 19:1285794-1285816 CCGCCCAGTCCCCGCGCGGCCGG + Intergenic
1161207721 19:3050432-3050454 CCGTGCAGTCCCAGCTACTCAGG - Intergenic
1162444002 19:10711294-10711316 ACCCGCAGTCCCAGCTACACAGG - Intronic
1162473603 19:10887002-10887024 CCCTGCAGTCCCAGCTCCTCAGG - Intronic
1163729484 19:18940988-18941010 CCTCGAAGTCCCAGGGCCAAGGG - Intronic
1165138802 19:33687142-33687164 CTGCAGAGTCCCAGCCCCACCGG - Intronic
1165595888 19:37011043-37011065 CAGCACAGTGCCACCGCCACAGG - Intronic
1165601824 19:37060406-37060428 CAGCACAGTGCCACCGCCACGGG - Intronic
1167033553 19:46979237-46979259 CCACGCAGGCCCAGTGGCACTGG - Intronic
1167429069 19:49443854-49443876 CCGCGCACTCCGAGGGCCGCTGG + Intergenic
1167582050 19:50350787-50350809 CAGTGCAGTCCCAGTGCTACTGG - Intronic
1168596478 19:57681952-57681974 CCGCGCACGCGCAGCGCGACGGG + Intronic
926320786 2:11746993-11747015 CCGCGCAGTCCCAGAACCGCGGG + Intronic
927685247 2:25166151-25166173 CCGTGCAGGCCCAGCGCCTGGGG - Intronic
927716336 2:25355792-25355814 CCCAGCTGTCCCAGCACCACAGG + Intergenic
929570336 2:43018901-43018923 CCAGGGAGTCCCAGGGCCACAGG - Intergenic
931035790 2:58241376-58241398 CCGCGGCGTCCGAGCGCCAGCGG - Intergenic
934943335 2:98518460-98518482 CCACTCAGTCCCAGCACCACAGG - Intronic
936386083 2:112030594-112030616 CTGAGCAGGCCCAGAGCCACTGG + Intergenic
936514136 2:113171103-113171125 CAGCGCAGTCCCAGGGTCCCAGG - Intronic
948627115 2:239276038-239276060 CAGGGCAGTCCCAGCCCCAGAGG - Intronic
948631220 2:239303885-239303907 CCAAGCATTCCCAGGGCCACGGG - Intronic
948813000 2:240494560-240494582 CTCCACAGTCCCAGGGCCACTGG + Intronic
1171023480 20:21608059-21608081 GGGCGCAGTCCCAGCGCCAGTGG - Intergenic
1171036156 20:21714407-21714429 CCGCGCAGTGCGAGAGGCACTGG - Intronic
1171122105 20:22577020-22577042 CCGCGCATTACCAGCGGAACGGG + Intergenic
1172013180 20:31858273-31858295 CCCCCCAGTCCCAGAGGCACAGG + Intronic
1175466091 20:59192057-59192079 CCGCGCTGTCGGAGCGCGACAGG - Exonic
1183465155 22:37976318-37976340 GCCCGCAGTCCCAGCTACACAGG - Intronic
1185392590 22:50570713-50570735 CTGCTCAGTCCCAGGACCACAGG + Intronic
952471557 3:33659047-33659069 CAGCTCAGTGCCTGCGCCACTGG + Exonic
954366894 3:50151154-50151176 CCGCCCAGCCCCAGCGTCGCTGG - Intergenic
957141340 3:76362237-76362259 CTGCGTAGTCCCAGCTCCTCGGG + Intronic
961665126 3:128489635-128489657 CCGCGGAGGCCCGGCGCCAAGGG - Intronic
961860055 3:129909575-129909597 CCCTGCAGTCCCAGCGACTCGGG - Intergenic
970332711 4:15002593-15002615 CCGCGCAACCCCAGCGCCGGCGG + Intergenic
974364296 4:60926556-60926578 CCCCGCAGTCCTAGATCCACGGG + Intergenic
980974281 4:139596257-139596279 CAGAGTAGTCCCAGCTCCACAGG + Intronic
982198491 4:152937630-152937652 CCCCGCAGTCCCCGCCCCGCAGG + Intronic
982734688 4:158993240-158993262 CCGGGTAGTCCCAGCTCCTCAGG + Intronic
984220090 4:176964499-176964521 CAGCTCAATCCCAGCTCCACGGG + Intergenic
985941516 5:3140331-3140353 GCTCGCAGTCCCAGCGACTCAGG + Intergenic
992828167 5:80569791-80569813 CCGCGGAGTCCAAGCCCCAGCGG + Intronic
1001993122 5:176133751-176133773 CCGCAGAGACCCAGCTCCACAGG - Intergenic
1013836640 6:114342562-114342584 CCGTGCCGTGCCCGCGCCACGGG - Exonic
1019272121 7:156268-156290 CTGCCCAGCCCCCGCGCCACAGG + Intergenic
1023360933 7:39414538-39414560 CCGCGGAGTCCCTGCGCATCGGG - Intronic
1029456232 7:100673902-100673924 CCGCAGAGTCCCACCGCCACAGG + Exonic
1034468960 7:151245663-151245685 CCGCCCACCCCCAGCGCCCCGGG - Exonic
1035261309 7:157663295-157663317 CCCTGGAGTCCCAGCGGCACTGG + Intronic
1036416518 8:8554599-8554621 CCAAGGAGTCCCAGCGTCACAGG - Intergenic
1038492835 8:27982526-27982548 CCAAGCAGTTCCAGCCCCACAGG + Intronic
1039843307 8:41308757-41308779 CCTCGCAGAGCCAGCGACACGGG + Exonic
1040039094 8:42897641-42897663 TCGCGCACTCCCACCGCCAGCGG - Intronic
1041186367 8:55305076-55305098 CCCTGTAGTCCCATCGCCACTGG - Intronic
1041259663 8:56009932-56009954 CCGCCCTGTCCCAGGGCTACAGG + Exonic
1041275870 8:56157179-56157201 CCGGGCTGTCCCAGAGCCGCAGG + Intergenic
1049252969 8:141598991-141599013 CCGCCCAGCCCCTGTGCCACAGG + Intergenic
1049408695 8:142462940-142462962 CTGCCCACTCACAGCGCCACGGG - Intronic
1049656956 8:143803268-143803290 CCGCCCAGACCCAGAGGCACAGG + Intronic
1049707968 8:144051534-144051556 CTGCGCAGTCCCCTCCCCACCGG + Intronic
1049802273 8:144523383-144523405 GGGCGCAGTCACAGCGCCATGGG + Exonic
1053533130 9:38901260-38901282 CCGCCTTGTTCCAGCGCCACAGG - Intergenic
1054205356 9:62125689-62125711 CCGCCTTGTTCCAGCGCCACAGG - Intergenic
1054633005 9:67462681-67462703 CCGCCTTGTTCCAGCGCCACAGG + Intergenic
1057421881 9:94919422-94919444 CCACGCAGTCTCAGGGCCAGAGG + Intronic
1062526218 9:136978995-136979017 CCGCGCTGAACCAGCGCCCCAGG - Exonic
1062722030 9:138049615-138049637 CCGCCCGGTCCCAGAGCCACCGG - Intronic
1186520281 X:10200150-10200172 GCCTGCAGTCCCAGCTCCACAGG - Intronic
1187920504 X:24196720-24196742 GCCTGCAGTCCCAGCTCCACAGG - Intronic
1190416362 X:50184139-50184161 CCACACAGTTCCAGCGCCACTGG - Intergenic
1192435616 X:71141875-71141897 CCACCCAGTTCCAGCGCCAGGGG + Exonic
1199881172 X:151974947-151974969 CCGCCCAGGCCCCGCGCCGCGGG - Intergenic