ID: 1063505055

View in Genome Browser
Species Human (GRCh38)
Location 10:6590274-6590296
Sequence AAGAACAAGCAGGAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063505050_1063505055 19 Left 1063505050 10:6590232-6590254 CCATGCCAATTTCTAAATGGAAT No data
Right 1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG No data
1063505051_1063505055 14 Left 1063505051 10:6590237-6590259 CCAATTTCTAAATGGAATCCAAT No data
Right 1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG No data
1063505052_1063505055 -4 Left 1063505052 10:6590255-6590277 CCAATAGCAAGAATGCACAAAGA No data
Right 1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063505055 Original CRISPR AAGAACAAGCAGGAGTGGTG AGG Intergenic
No off target data available for this crispr