ID: 1063506157

View in Genome Browser
Species Human (GRCh38)
Location 10:6601597-6601619
Sequence CTGTGAACACAGATGAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063506156_1063506157 -10 Left 1063506156 10:6601584-6601606 CCACGGAGAGCGGCTGTGAACAC No data
Right 1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063506157 Original CRISPR CTGTGAACACAGATGAAGTT TGG Intergenic
No off target data available for this crispr