ID: 1063506857

View in Genome Browser
Species Human (GRCh38)
Location 10:6607435-6607457
Sequence GTGTGGTATGTGAGGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063506857_1063506863 25 Left 1063506857 10:6607435-6607457 CCCACCAGCCTCACATACCACAC No data
Right 1063506863 10:6607483-6607505 TCACATTTGACACCCACCCTGGG No data
1063506857_1063506862 24 Left 1063506857 10:6607435-6607457 CCCACCAGCCTCACATACCACAC No data
Right 1063506862 10:6607482-6607504 GTCACATTTGACACCCACCCTGG No data
1063506857_1063506864 26 Left 1063506857 10:6607435-6607457 CCCACCAGCCTCACATACCACAC No data
Right 1063506864 10:6607484-6607506 CACATTTGACACCCACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063506857 Original CRISPR GTGTGGTATGTGAGGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr