ID: 1063508037

View in Genome Browser
Species Human (GRCh38)
Location 10:6619308-6619330
Sequence TTGTAAATGCCTATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063508037_1063508041 5 Left 1063508037 10:6619308-6619330 CCATCCTCCATAGGCATTTACAA No data
Right 1063508041 10:6619336-6619358 AATTTGATTCCTTCTATCCCTGG No data
1063508037_1063508043 16 Left 1063508037 10:6619308-6619330 CCATCCTCCATAGGCATTTACAA No data
Right 1063508043 10:6619347-6619369 TTCTATCCCTGGTCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063508037 Original CRISPR TTGTAAATGCCTATGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr