ID: 1063519375

View in Genome Browser
Species Human (GRCh38)
Location 10:6727024-6727046
Sequence GGTGGGATAATTGTTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063519366_1063519375 24 Left 1063519366 10:6726977-6726999 CCAGTTATGGATTTCTAGAGCAT No data
Right 1063519375 10:6727024-6727046 GGTGGGATAATTGTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063519375 Original CRISPR GGTGGGATAATTGTTCTTGA TGG Intergenic
No off target data available for this crispr