ID: 1063531989

View in Genome Browser
Species Human (GRCh38)
Location 10:6842181-6842203
Sequence CTTGGTGCAAATTAATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063531984_1063531989 19 Left 1063531984 10:6842139-6842161 CCCTCTGTACAGATTGCAATATC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1063531989 10:6842181-6842203 CTTGGTGCAAATTAATTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 118
1063531985_1063531989 18 Left 1063531985 10:6842140-6842162 CCTCTGTACAGATTGCAATATCT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1063531989 10:6842181-6842203 CTTGGTGCAAATTAATTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063531989 Original CRISPR CTTGGTGCAAATTAATTGCC TGG Intergenic
910008052 1:82424445-82424467 GTTGGGGCAAACTACTTGCCTGG + Intergenic
912460561 1:109828224-109828246 CTTGGGCCAAGTTAAATGCCAGG + Intergenic
913115447 1:115692343-115692365 CTTGGAGCCACTTAATTTCCTGG + Exonic
915521470 1:156447350-156447372 CTTTTTAAAAATTAATTGCCGGG - Intergenic
916207547 1:162330206-162330228 CTTGGGGAAAATGAATAGCCAGG + Intronic
917378096 1:174372804-174372826 GGTAGTGCAAATGAATTGCCAGG - Intronic
921150720 1:212400408-212400430 CTTGGAACAAATTACTTGCATGG + Intronic
921826285 1:219675442-219675464 CTGGGTGCATATTATATGCCAGG - Intergenic
922403997 1:225292816-225292838 CTTTGTTCAAATTTATTCCCAGG + Intronic
923859222 1:237876394-237876416 CCTGTTGAAATTTAATTGCCAGG + Intergenic
1063531989 10:6842181-6842203 CTTGGTGCAAATTAATTGCCTGG + Intergenic
1064488228 10:15819995-15820017 CTAGGTACATATTAAGTGCCAGG - Intronic
1065534456 10:26703654-26703676 CTTGTTGCACTGTAATTGCCTGG + Intronic
1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG + Intergenic
1070800614 10:79242750-79242772 GTTGCTTCCAATTAATTGCCTGG + Intronic
1071139376 10:82489734-82489756 AGTTGTGCAAATGAATTGCCTGG - Intronic
1073471858 10:103727489-103727511 CTCTGTGCAAAGTCATTGCCGGG + Intronic
1074763836 10:116686421-116686443 CTTGCTGCAAAGAAACTGCCAGG + Intronic
1080271715 11:30457555-30457577 CTTGGTGCCCATTAAATTCCAGG + Intronic
1087923261 11:103891041-103891063 CTTGCTACAAATTAAATGCTTGG + Intergenic
1088090413 11:106032174-106032196 GTTGGTCCAATTTAATTGCAAGG + Intergenic
1090633215 11:128668910-128668932 CTTGGAGCAAATTAAATGACAGG - Intergenic
1096517051 12:52162497-52162519 CTTGAAGAAAATTAAATGCCAGG + Intergenic
1097741457 12:63247624-63247646 TTTGTAGCAAATTACTTGCCTGG + Intergenic
1097766059 12:63528112-63528134 CTTTGTCCAAATTAATGTCCTGG + Intergenic
1100602690 12:96125735-96125757 CTTGGAGCAAATTGAAAGCCTGG + Intergenic
1106731472 13:32545569-32545591 CATGGTACATATTATTTGCCTGG + Intergenic
1108112783 13:47094421-47094443 CTTGGTGTAAATAAACAGCCTGG - Intergenic
1108286341 13:48912477-48912499 CTTTGGGCAAATTCATTACCTGG - Intergenic
1108326344 13:49335719-49335741 CTTGCTGGTAATTAAATGCCAGG + Intronic
1109831344 13:67793661-67793683 CTTGATCAAAATTGATTGCCTGG + Intergenic
1111605595 13:90534809-90534831 CATGGTGGAAAATAATTCCCAGG + Intergenic
1116134128 14:40898849-40898871 CCTTGGGCAAATTAATTTCCTGG + Intergenic
1116681576 14:47977187-47977209 CTTGATGTAAATAAATTTCCAGG + Intergenic
1116735909 14:48691275-48691297 CTTGGTTCCTAGTAATTGCCAGG + Intergenic
1121997091 14:98611224-98611246 CTTGGTCCAAAGTAGATGCCAGG + Intergenic
1126186924 15:45839754-45839776 CTTATTGCAAATTAATTCACTGG - Intergenic
1127991949 15:64125942-64125964 CTTGGAGAAAGTTATTTGCCAGG + Intronic
1131382457 15:91975075-91975097 TTTAGTGCAAATAAAGTGCCTGG + Intronic
1131613220 15:93986801-93986823 CTGGGTGCGAATTAAATCCCAGG + Intergenic
1135931386 16:26740501-26740523 CTTCGTGGAAATCAATTACCAGG - Intergenic
1136131553 16:28225175-28225197 CATGGAGCAAAGGAATTGCCTGG + Intergenic
1137454901 16:48610423-48610445 GTTGGGGAAACTTAATTGCCAGG + Intronic
1138034257 16:53587599-53587621 ATTGCTACAAATTAAATGCCTGG + Intergenic
1138113620 16:54343207-54343229 CTTGGGGCAAATGACTAGCCTGG - Intergenic
1153414527 18:4832079-4832101 CTTGGTGCCACTTATTTGCCAGG + Intergenic
1155405611 18:25483648-25483670 CTTTGTCCAAATATATTGCCAGG + Intergenic
1155658201 18:28215972-28215994 CTTGGTTTTAATTAATTGTCTGG + Intergenic
1157035840 18:43972192-43972214 CTTGCTGCACATTAATGGTCTGG + Intergenic
1168585186 19:57586027-57586049 CTTAATGAAAATTAATTGGCTGG - Intronic
925444400 2:3915396-3915418 CTTGTTACAAACTAATTGCTGGG - Intergenic
929728507 2:44459370-44459392 TTTTGTGCACATTAAATGCCTGG + Intronic
930388865 2:50734925-50734947 CTTGGTGCATATTAAAAGGCTGG - Intronic
930784910 2:55262247-55262269 CTCGTTGCAAATAAAATGCCCGG + Intronic
933540771 2:83639137-83639159 GTTGGTGCAAAATTAATGCCAGG + Intergenic
934848929 2:97684333-97684355 CTTGTTGAAAATCAATTGACTGG - Intergenic
937376881 2:121343050-121343072 CTTGTTGAAAATTATTTGACTGG - Intronic
938230715 2:129656276-129656298 CTTAGAGCAAGTTAATTTCCGGG + Intergenic
938560313 2:132466678-132466700 CTGTGTGCAAATTAGTTGCTGGG + Intronic
940816589 2:158304120-158304142 CTTGGTTCAAAATCAGTGCCTGG + Intronic
941638714 2:167963742-167963764 CCTGGTGCTAATTAACTTCCTGG - Intronic
941836669 2:170029220-170029242 CTTGGTGAATTTTAATTGTCAGG + Intronic
943709694 2:191077210-191077232 CTTGGTGCAAATTAAAATACTGG + Intronic
1170403314 20:16010754-16010776 CTTGGTACAAAGTGATTGCCAGG - Intronic
1174984147 20:55431005-55431027 CTTTGTGGAACTTAAGTGCCAGG - Intergenic
1176991827 21:15506416-15506438 CTTGGTACAACATATTTGCCTGG + Intergenic
1184363997 22:44037762-44037784 CTGGGTGCAGCTTAAATGCCAGG - Intronic
949834084 3:8249117-8249139 CTTTTTGCAAATGACTTGCCTGG + Intergenic
951559072 3:23947541-23947563 CCTGTTGCAAATGAATTCCCTGG + Intronic
952212041 3:31237689-31237711 ATTGATGCAAATAATTTGCCAGG - Intergenic
954545316 3:51429323-51429345 CTTGTTCCAATTTAATGGCCAGG + Exonic
955457730 3:59142609-59142631 TTTGATACAAATTAATTGGCAGG - Intergenic
956497178 3:69840304-69840326 GTTTGAGAAAATTAATTGCCCGG + Intronic
959006352 3:101024881-101024903 CTTGGTACAAATTCTTTGTCTGG + Intergenic
966270583 3:178099849-178099871 ATTGGTGCAATTTAGTTACCTGG - Intergenic
968890194 4:3364727-3364749 CTTTGGGTAAATTTATTGCCGGG + Intronic
971448182 4:26775149-26775171 CATGTTGAAATTTAATTGCCAGG + Intergenic
972336573 4:38112221-38112243 CTTTGTGAAAATTAGTTGCTTGG + Intronic
973836582 4:54816192-54816214 CTGGGAGCAAAATATTTGCCAGG - Intergenic
975298422 4:72761411-72761433 CTTTGTGCAAATTAGATGACAGG + Intergenic
978753695 4:112281475-112281497 CTTGGGGCAGATCAATTGTCTGG + Intronic
979305939 4:119143492-119143514 CATGTTGAAATTTAATTGCCAGG - Intronic
982993130 4:162304977-162304999 TTTGGCTCCAATTAATTGCCTGG - Intergenic
985219455 4:187687960-187687982 CTTGGTGCAAGTAAAATGGCTGG + Intergenic
985431193 4:189881795-189881817 CTTGGTGGAAATTCAGTGGCAGG + Intergenic
987705302 5:21456048-21456070 CTTGGTGCAAATTAAACCCCGGG + Intergenic
987814911 5:22887479-22887501 CTGTGAGCAAATTAAATGCCAGG + Intergenic
988300627 5:29421149-29421171 CTTGGTGCAAATTAAAGCCAGGG - Intergenic
989951334 5:50301218-50301240 TTTGGTACAAATTACTTGCAAGG + Intergenic
990124848 5:52501886-52501908 CTTCGTGCAAATAATTTGCCTGG + Intergenic
993625484 5:90219513-90219535 CTTCATGCACATTAATAGCCTGG + Intergenic
994035744 5:95198678-95198700 TTTGATGCAAATTAATTTCACGG + Intronic
996273307 5:121635190-121635212 CTTGTTGCAAAGTGATTGCTAGG + Intergenic
996323407 5:122245212-122245234 CTTGTTGAAAATTAATTGTTTGG + Intergenic
997676690 5:135718285-135718307 CTTGATGAAAAGTAATAGCCGGG + Intergenic
998043128 5:138966118-138966140 CTTGTTGAAAATTACATGCCAGG - Intronic
1001055226 5:168443859-168443881 CTGGGTGCCAATTATGTGCCAGG + Intronic
1002933737 6:1653654-1653676 CTTGTTGAAAATCAATTGGCCGG - Intronic
1003470972 6:6432100-6432122 CTTGCTGAAAATGAATTGACTGG - Intergenic
1004199701 6:13536236-13536258 CTTGGTGCAAATTACCTGTGGGG + Intergenic
1005342643 6:24857764-24857786 CTTTGTTCAAATTAAGTTCCAGG - Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1006652749 6:35565209-35565231 CTTGCTGCATATTAAATGCTCGG + Intergenic
1009023002 6:57964858-57964880 CTTGGTGCAAATTAAACCCCGGG - Intergenic
1010397124 6:75405326-75405348 CTTAGTGGAAATTAATTGTGTGG - Intronic
1013175972 6:107676769-107676791 CTTGGTGGAAATAAACTACCTGG + Intergenic
1018611915 6:165655108-165655130 CTGGGTGCAATGTAAGTGCCTGG - Intronic
1019500466 7:1362061-1362083 TTTTGTGAAAATGAATTGCCTGG + Intergenic
1022871140 7:34481140-34481162 TTAGGTGCATACTAATTGCCAGG + Intergenic
1023646495 7:42322359-42322381 CTTGTTGAAAATTAGTTGACTGG + Intergenic
1023689917 7:42775010-42775032 TTTAGTGCCATTTAATTGCCTGG - Intergenic
1023720675 7:43090679-43090701 TTTGGTTCACATGAATTGCCTGG + Intergenic
1026409539 7:70105774-70105796 CTTGGCTCTAGTTAATTGCCAGG + Intronic
1036994391 8:13638519-13638541 CTTGTTGCAAAATGATTGCAGGG - Intergenic
1039032791 8:33328156-33328178 CTTGGTGAAACATAATTTCCAGG + Intergenic
1048966688 8:139619987-139620009 CTTGATGCAACTTCATTGCGTGG + Intronic
1050098944 9:2098185-2098207 CCTGGTGGCAATTATTTGCCAGG + Intronic
1056174542 9:84021201-84021223 CTTGTTGAAATTTAATTGCCTGG - Intergenic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1187031828 X:15495820-15495842 CTTGGAGCCAATTGATTTCCTGG - Intronic
1189178780 X:38983482-38983504 CTGGGTGCCAACTAAGTGCCAGG - Intergenic
1192100913 X:68263554-68263576 TTTAGTGCATATTATTTGCCAGG + Intronic
1192227493 X:69239048-69239070 CTTGGTGCCAATTCTGTGCCAGG + Intergenic
1193964089 X:87962104-87962126 CTTGGTTTGAATTAATTGCTGGG - Intergenic
1198022044 X:132668585-132668607 CTTGGTGCATATTAGTTACTAGG + Intronic
1198997985 X:142597494-142597516 CTTGTTGCTAACTAATTTCCTGG - Intergenic
1200048638 X:153416465-153416487 TTTGGAGCAATTTAAATGCCAGG + Intergenic