ID: 1063540384

View in Genome Browser
Species Human (GRCh38)
Location 10:6927820-6927842
Sequence AGCCTTAGCCCTTGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063540384_1063540390 10 Left 1063540384 10:6927820-6927842 CCCACCACCCAAGGGCTAAGGCT No data
Right 1063540390 10:6927853-6927875 GTTGAAAACTTCAGCACAGCAGG No data
1063540384_1063540391 11 Left 1063540384 10:6927820-6927842 CCCACCACCCAAGGGCTAAGGCT No data
Right 1063540391 10:6927854-6927876 TTGAAAACTTCAGCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063540384 Original CRISPR AGCCTTAGCCCTTGGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr