ID: 1063549094

View in Genome Browser
Species Human (GRCh38)
Location 10:7012103-7012125
Sequence CAGTTGAAGCAGAGGCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063549094_1063549098 30 Left 1063549094 10:7012103-7012125 CCATACAGCCTCTGCTTCAACTG No data
Right 1063549098 10:7012156-7012178 CATACACAAACAAGTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063549094 Original CRISPR CAGTTGAAGCAGAGGCTGTA TGG (reversed) Intergenic
No off target data available for this crispr