ID: 1063552357

View in Genome Browser
Species Human (GRCh38)
Location 10:7045018-7045040
Sequence CACTGGATAAGGAGTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063552349_1063552357 27 Left 1063552349 10:7044968-7044990 CCGTGTTCAGCATCAGCAGGGAA No data
Right 1063552357 10:7045018-7045040 CACTGGATAAGGAGTGATGATGG No data
1063552352_1063552357 -2 Left 1063552352 10:7044997-7045019 CCTTGGCTCTCCACTGGCAACCA No data
Right 1063552357 10:7045018-7045040 CACTGGATAAGGAGTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063552357 Original CRISPR CACTGGATAAGGAGTGATGA TGG Intergenic
No off target data available for this crispr