ID: 1063556158

View in Genome Browser
Species Human (GRCh38)
Location 10:7081540-7081562
Sequence CAGTGCTAGAACTCCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063556158_1063556168 28 Left 1063556158 10:7081540-7081562 CCCACGTGGGAGTTCTAGCACTG No data
Right 1063556168 10:7081591-7081613 TCCCTGCAGGTGGGCGATGCAGG No data
1063556158_1063556163 18 Left 1063556158 10:7081540-7081562 CCCACGTGGGAGTTCTAGCACTG No data
Right 1063556163 10:7081581-7081603 CTCCCCAGTTTCCCTGCAGGTGG No data
1063556158_1063556164 19 Left 1063556158 10:7081540-7081562 CCCACGTGGGAGTTCTAGCACTG No data
Right 1063556164 10:7081582-7081604 TCCCCAGTTTCCCTGCAGGTGGG No data
1063556158_1063556162 15 Left 1063556158 10:7081540-7081562 CCCACGTGGGAGTTCTAGCACTG No data
Right 1063556162 10:7081578-7081600 TCTCTCCCCAGTTTCCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063556158 Original CRISPR CAGTGCTAGAACTCCCACGT GGG (reversed) Intergenic
No off target data available for this crispr