ID: 1063559279

View in Genome Browser
Species Human (GRCh38)
Location 10:7111514-7111536
Sequence GACCTCACCCCCTGTTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063559278_1063559279 -10 Left 1063559278 10:7111501-7111523 CCTCACTTCTGAAGACCTCACCC No data
Right 1063559279 10:7111514-7111536 GACCTCACCCCCTGTTCTTCTGG No data
1063559277_1063559279 -6 Left 1063559277 10:7111497-7111519 CCTTCCTCACTTCTGAAGACCTC No data
Right 1063559279 10:7111514-7111536 GACCTCACCCCCTGTTCTTCTGG No data
1063559273_1063559279 29 Left 1063559273 10:7111462-7111484 CCTGCTGTGCTTCATCATGGATG No data
Right 1063559279 10:7111514-7111536 GACCTCACCCCCTGTTCTTCTGG No data
1063559276_1063559279 -5 Left 1063559276 10:7111496-7111518 CCCTTCCTCACTTCTGAAGACCT No data
Right 1063559279 10:7111514-7111536 GACCTCACCCCCTGTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063559279 Original CRISPR GACCTCACCCCCTGTTCTTC TGG Intergenic
No off target data available for this crispr