ID: 1063559453

View in Genome Browser
Species Human (GRCh38)
Location 10:7112828-7112850
Sequence CTGCCTTGGTGGGGTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063559446_1063559453 -4 Left 1063559446 10:7112809-7112831 CCACAGAGGCACTTTGAGGCTGC No data
Right 1063559453 10:7112828-7112850 CTGCCTTGGTGGGGTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063559453 Original CRISPR CTGCCTTGGTGGGGTGGGAG AGG Intergenic
No off target data available for this crispr