ID: 1063560286

View in Genome Browser
Species Human (GRCh38)
Location 10:7119810-7119832
Sequence TTCCCATGACAATGCTATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063560286_1063560290 2 Left 1063560286 10:7119810-7119832 CCCCTATAGCATTGTCATGGGAA No data
Right 1063560290 10:7119835-7119857 TACAGAAAAGATCACAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063560286 Original CRISPR TTCCCATGACAATGCTATAG GGG (reversed) Intergenic
No off target data available for this crispr