ID: 1063566912

View in Genome Browser
Species Human (GRCh38)
Location 10:7179314-7179336
Sequence CCCTCTCCGTGCCTTTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063566908_1063566912 2 Left 1063566908 10:7179289-7179311 CCATTGACCCTATGTGTAGAGAC 0: 1
1: 0
2: 1
3: 16
4: 233
Right 1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG No data
1063566907_1063566912 5 Left 1063566907 10:7179286-7179308 CCTCCATTGACCCTATGTGTAGA 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG No data
1063566910_1063566912 -6 Left 1063566910 10:7179297-7179319 CCTATGTGTAGAGACTTCCCTCT 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG No data
1063566909_1063566912 -5 Left 1063566909 10:7179296-7179318 CCCTATGTGTAGAGACTTCCCTC 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG No data
1063566906_1063566912 6 Left 1063566906 10:7179285-7179307 CCCTCCATTGACCCTATGTGTAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063566912 Original CRISPR CCCTCTCCGTGCCTTTGAAG AGG Intronic
No off target data available for this crispr