ID: 1063570825

View in Genome Browser
Species Human (GRCh38)
Location 10:7213278-7213300
Sequence CCTACTGTGTATTAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063570820_1063570825 28 Left 1063570820 10:7213227-7213249 CCCAGAACTTAAAGTAAAATAAA 0: 688
1: 5678
2: 13014
3: 20263
4: 9805
Right 1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG No data
1063570821_1063570825 27 Left 1063570821 10:7213228-7213250 CCAGAACTTAAAGTAAAATAAAA 0: 598
1: 2363
2: 3964
3: 4006
4: 5229
Right 1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063570825 Original CRISPR CCTACTGTGTATTAGGAGGA AGG Intronic
No off target data available for this crispr