ID: 1063576535

View in Genome Browser
Species Human (GRCh38)
Location 10:7266615-7266637
Sequence CTTTTGCTCCTGCCTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063576535_1063576540 18 Left 1063576535 10:7266615-7266637 CCACAGGGAGGCAGGAGCAAAAG 0: 1
1: 1
2: 6
3: 47
4: 392
Right 1063576540 10:7266656-7266678 CAGTTTCAACAGAAGCCCTCTGG No data
1063576535_1063576543 30 Left 1063576535 10:7266615-7266637 CCACAGGGAGGCAGGAGCAAAAG 0: 1
1: 1
2: 6
3: 47
4: 392
Right 1063576543 10:7266668-7266690 AAGCCCTCTGGCTGCAGTCGGGG No data
1063576535_1063576542 29 Left 1063576535 10:7266615-7266637 CCACAGGGAGGCAGGAGCAAAAG 0: 1
1: 1
2: 6
3: 47
4: 392
Right 1063576542 10:7266667-7266689 GAAGCCCTCTGGCTGCAGTCGGG No data
1063576535_1063576541 28 Left 1063576535 10:7266615-7266637 CCACAGGGAGGCAGGAGCAAAAG 0: 1
1: 1
2: 6
3: 47
4: 392
Right 1063576541 10:7266666-7266688 AGAAGCCCTCTGGCTGCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063576535 Original CRISPR CTTTTGCTCCTGCCTCCCTG TGG (reversed) Intronic
900076820 1:824129-824151 CAATAGCTCCTGCCTTCCTGAGG + Intergenic
900430057 1:2597133-2597155 CTCGTGCTCCTGTGTCCCTGGGG - Intronic
900476951 1:2880419-2880441 CTTCTGTTCCTGCTGCCCTGGGG - Intergenic
900813753 1:4827709-4827731 GGTTTACTTCTGCCTCCCTGTGG - Intergenic
901316689 1:8314743-8314765 GTGTGGCTCCTGCTTCCCTGGGG + Intergenic
901373011 1:8817040-8817062 CTTTTCTTCCTGCCTCCCCCCGG + Intronic
902416224 1:16241281-16241303 CTGCTGCTCCTGCTGCCCTGTGG - Intergenic
902670204 1:17967895-17967917 GTTTTGCTCCTGACTCTCTAGGG - Intergenic
902821371 1:18945336-18945358 GTTTTGCTCCTGGCCCACTGTGG - Intronic
904001133 1:27339433-27339455 CCTCTTCTCCTGCCTCCTTGCGG - Intergenic
904360317 1:29966923-29966945 CCTCTGCTCCTGCCTTCCTCTGG + Intergenic
904454084 1:30636498-30636520 CTGGGGCTCCTGCCTCACTGGGG - Intergenic
904750256 1:32737415-32737437 TTTTTGCTGGTTCCTCCCTGGGG + Intergenic
905167619 1:36092190-36092212 CTTCTGCCCATGCCTCCCTAGGG - Intronic
905222642 1:36459476-36459498 CATTTGTTCCTGCCAACCTGGGG + Intronic
905408527 1:37753319-37753341 CTGCTTCTCCTGCCTCACTGGGG - Intronic
906204871 1:43981382-43981404 CTCTAGCTCCGGGCTCCCTGAGG + Exonic
906250030 1:44303962-44303984 CTGTTGCTTCTGCCTCCCAGAGG - Intronic
906945101 1:50288649-50288671 CTATAGCTCCAGCCTCCCTCCGG + Intergenic
908740486 1:67322510-67322532 CCTTCCCTCTTGCCTCCCTGGGG - Intronic
909278576 1:73720431-73720453 TTTTGGCTGCTGCCACCCTGAGG - Intergenic
912799193 1:112710743-112710765 CTTTCTCTCCTGCTTCCCTGAGG - Exonic
913202885 1:116510499-116510521 CTTTTGCTCCAGGCTACATGTGG + Intergenic
915912529 1:159923712-159923734 CTTCTGCTCCTGACTCTCGGTGG - Exonic
915919593 1:159964426-159964448 GCTTTGCACCTGCTTCCCTGCGG - Intergenic
917454071 1:175170776-175170798 GTTCTGCTCCTCCCTCCCTCCGG + Intronic
918668046 1:187177280-187177302 CTGTTTCTCCTGCCTCCATGTGG - Intergenic
920418536 1:205814023-205814045 CTTTCGCCACTTCCTCCCTGGGG + Intergenic
920602807 1:207346380-207346402 CTTGTCCTCAGGCCTCCCTGTGG + Intronic
922196022 1:223361487-223361509 CTTTTTTCCCTGCCTTCCTGTGG - Intronic
1062801540 10:384882-384904 CTTCTCCTCCTCCTTCCCTGGGG - Intronic
1063371140 10:5523866-5523888 CGCCTGCTCCTGCCTCTCTGGGG + Intergenic
1063576535 10:7266615-7266637 CTTTTGCTCCTGCCTCCCTGTGG - Intronic
1063667481 10:8072476-8072498 AATCTGCTTCTGCCTCCCTGTGG + Intronic
1063735276 10:8746664-8746686 TTTTGACTTCTGCCTCCCTGTGG - Intergenic
1063826249 10:9900978-9901000 CTTTTGCCCATCCCTCCCTTAGG - Intergenic
1063883550 10:10554593-10554615 CTTTGCTTCCAGCCTCCCTGTGG + Intergenic
1065963946 10:30755572-30755594 TTTTTGTTCCTGCTTCCCAGTGG + Intergenic
1067056872 10:43057656-43057678 CATTTCCCTCTGCCTCCCTGGGG + Intergenic
1067056885 10:43057696-43057718 CCCTTGCTCCTGCCTCCCTGGGG + Intergenic
1067510458 10:46890812-46890834 CTTTTTCTCTTGCCTCCCTGTGG + Intergenic
1067540570 10:47148822-47148844 ATTTTGTTCCTGCCTACCTATGG - Intergenic
1067651796 10:48161050-48161072 CTTTTTCTCTTGCCTCCCTGTGG - Intronic
1067658005 10:48211832-48211854 CCCTTGCTCATGCCTCCTTGTGG + Intronic
1067660670 10:48234465-48234487 CCTTTCCTTCTGCTTCCCTGTGG - Intronic
1069895966 10:71680233-71680255 CCCTTGGTCCTGCCTCCCTTTGG + Intronic
1069932570 10:71892500-71892522 CTTTCTCTCCTGGCTGCCTGAGG + Intergenic
1070961751 10:80504498-80504520 CTTTTCCTCTTCCTTCCCTGGGG + Intronic
1072683240 10:97521620-97521642 CTGCTGCTCCTGCCTGCCTGAGG - Intronic
1073896654 10:108168224-108168246 CTTTTCTTCCTGGCTCCCTGTGG - Intergenic
1074317015 10:112369964-112369986 CCTTAGCTGCTGCCTCCCTGTGG + Intergenic
1074428903 10:113376039-113376061 CTTTTGCATCTTCCTCCTTGTGG + Intergenic
1074600228 10:114906648-114906670 GTTATCCTCCTGCCTTCCTGAGG + Intergenic
1075951186 10:126479101-126479123 CTTTTTCTCCTCACACCCTGCGG - Intronic
1076319236 10:129565978-129566000 CTGTGGCTCCAGCCTGCCTGGGG - Intronic
1076526480 10:131115605-131115627 CTTTTCCTTCTGGTTCCCTGAGG + Intronic
1076731776 10:132442817-132442839 CACTTCCTCCTGCCTCCCCGAGG + Intergenic
1076736322 10:132460811-132460833 CCCTTGCTTCTGCCTCCCAGGGG + Intergenic
1076849143 10:133084451-133084473 ATGTGGCTCCTGCCTCACTGTGG - Intronic
1077243384 11:1523772-1523794 CTCTTCTTCCTGCCTTCCTGCGG - Intergenic
1077542154 11:3151823-3151845 CACCTTCTCCTGCCTCCCTGGGG + Intronic
1077927791 11:6698989-6699011 CTTTTGCTGGTACTTCCCTGTGG + Intergenic
1078013485 11:7592423-7592445 CTTTTGCTCTGGCATCCCTCTGG + Intronic
1079096019 11:17510676-17510698 CCCTTGCTGCTGCCTCCTTGAGG - Intronic
1079365016 11:19801475-19801497 CTTTTCCTCTTCCCTCTCTGAGG + Intronic
1080050969 11:27858764-27858786 CCTTTGCTCATACCTCCTTGAGG + Intergenic
1080485770 11:32704991-32705013 CTTTTGCTCCTGCCATCTGGTGG - Intronic
1081461324 11:43275285-43275307 CTTTTCCTCCAGCCTGCCTTTGG - Intergenic
1081602924 11:44507732-44507754 CTTTTTCTCCTTCCTCCTTCTGG - Intergenic
1082042103 11:47694637-47694659 CTTTTGTTACTGCCTCCCTCAGG - Intronic
1083303359 11:61750171-61750193 CTTGTGCCCCACCCTCCCTGGGG + Intergenic
1083848570 11:65351946-65351968 GTGTTGCTCCTTTCTCCCTGAGG - Exonic
1084055074 11:66626689-66626711 CTTTTCTCCCTCCCTCCCTGTGG - Exonic
1087620910 11:100540689-100540711 CTTTACCCCATGCCTCCCTGAGG + Intergenic
1088658121 11:112020922-112020944 CTTTTTCTCCAGACTTCCTGGGG - Intronic
1088867689 11:113864338-113864360 CTTTTGCTTCTGTTTCTCTGGGG - Intronic
1090320898 11:125842731-125842753 CCTTTGCTCCTGCAGCCCTAGGG + Intergenic
1090973512 11:131662768-131662790 CCTTCCCTCCTGGCTCCCTGTGG + Intronic
1091234881 11:134014691-134014713 TTGTTCCTCCTGCCTCACTGAGG - Intergenic
1092775865 12:11944751-11944773 CTTTTGCTCCTTATTCCATGTGG - Intergenic
1093542544 12:20304760-20304782 GTTGTACTCCTGCATCCCTGAGG + Intergenic
1094613236 12:32013508-32013530 CTTTTTCTTCTGCCCTCCTGGGG + Intergenic
1095584643 12:43836362-43836384 CCTCTGCTCCTGCCTTCCTGGGG + Intronic
1096650489 12:53059847-53059869 CCTCTGCTCTTGCCTGCCTGTGG + Exonic
1097268616 12:57760461-57760483 CTTTGCCTCCTTCCTCCCTGGGG + Intergenic
1097423198 12:59407918-59407940 CCTCTGCACGTGCCTCCCTGTGG + Intergenic
1097785322 12:63752621-63752643 CTTCTGACCCTGCCTTCCTGGGG + Intergenic
1098442040 12:70529160-70529182 CTTTTCCTCCTGCCTCACTGAGG - Intronic
1098646763 12:72911497-72911519 CTTCTTCCCCTTCCTCCCTGAGG + Intergenic
1100817971 12:98404195-98404217 CTTTTCCTGCCTCCTCCCTGTGG - Intergenic
1101638211 12:106565146-106565168 CTGCTGCTGCTGCCTCTCTGTGG - Intronic
1101832748 12:108272065-108272087 CTTTTTCTCCAGCCCCTCTGTGG + Intergenic
1102602129 12:114039398-114039420 CACTTGCTCCTGACTCCCAGTGG - Intergenic
1102867075 12:116382943-116382965 CCTTTCTTCCTGCCTCTCTGAGG + Intergenic
1103364251 12:120370129-120370151 CTTTTCCTCCAGCCTCGGTGTGG - Intergenic
1103526716 12:121574159-121574181 CTGTTCCTCCTGCTTCCTTGGGG - Intronic
1104089482 12:125503239-125503261 CTTTGTCTCCTGGCACCCTGGGG + Intronic
1106024165 13:25941151-25941173 GTACTGCTCCTGCTTCCCTGGGG + Intronic
1108097680 13:46921348-46921370 GTTTTGTTTCTGCCTTCCTGTGG + Intergenic
1108601388 13:51998097-51998119 CTTTAAGTCCTGCCTCTCTGTGG + Intronic
1112048586 13:95622617-95622639 CTCCTGCTTCTGCTTCCCTGTGG + Intronic
1112287437 13:98116749-98116771 CTCTTGCCTCTGCCTCCCTCTGG + Intergenic
1113955322 13:114097368-114097390 TGTTTGCTCCTGGCGCCCTGTGG - Intronic
1114721111 14:24882606-24882628 CTCTTTCACATGCCTCCCTGGGG + Intronic
1114733108 14:25015416-25015438 CTTTATTTTCTGCCTCCCTGGGG - Intronic
1115310525 14:31974313-31974335 CTTTTGCTCCTGCCATTCAGTGG + Intergenic
1116693232 14:48137698-48137720 CTCTCGCTCCTGCTGCCCTGTGG + Intergenic
1117802144 14:59455293-59455315 GTCTTGCTGCTGCCTTCCTGAGG - Intronic
1118384288 14:65242895-65242917 ACTTTGTTCCTGCCTTCCTGTGG + Intergenic
1119074054 14:71618187-71618209 CCCTGGGTCCTGCCTCCCTGGGG + Intronic
1120153521 14:81064808-81064830 CTTTAGCTTCTCCCTCTCTGCGG - Intronic
1122044966 14:99016874-99016896 CTTTTGTTCTGGGCTCCCTGGGG + Intergenic
1122135086 14:99628149-99628171 CCTGGGCTCCTGCCTGCCTGGGG - Intergenic
1125351498 15:38772163-38772185 CTGTAGCTCCGGCCTCCCAGAGG + Intergenic
1125421968 15:39512870-39512892 CTCTTGCTGCTGCCTCCCAATGG + Intergenic
1125728461 15:41880105-41880127 GCCTTGCCCCTGCCTCCCTGTGG - Intronic
1126144783 15:45464361-45464383 CTTCTGCTACTGCTTCCCTAGGG + Intergenic
1127587385 15:60391427-60391449 CTTGTTCTTCTGCCACCCTGGGG - Intronic
1127826881 15:62711800-62711822 TTTTTGCTCCTGCTTACCAGAGG + Intronic
1129393751 15:75233425-75233447 CTCTTGCCCCTGCAACCCTGAGG - Intergenic
1130052511 15:80495682-80495704 CTTTTGCTCATGCCTTCCTAGGG + Intronic
1130570950 15:85043284-85043306 CTTTGGCTCCCTGCTCCCTGGGG + Intronic
1132387867 15:101413451-101413473 TTTTTTTTCCTGCCTTCCTGTGG - Intronic
1132533773 16:467234-467256 CTTCTGACCCTGCCTCCCTGTGG - Intronic
1133034744 16:3028467-3028489 CTTCTGCTCCTGCCCGCCTAGGG - Exonic
1133645090 16:7756507-7756529 CTTTTGTTCCTGCAGCCCTAGGG + Intergenic
1133769608 16:8860077-8860099 TTTTTGCCCCTGCTTCCCTGTGG - Intronic
1134090363 16:11388325-11388347 TTCCTGCTCCTGCCTTCCTGCGG - Intronic
1135304647 16:21357586-21357608 CTTTTGTCCCTGCCTCACTGGGG + Intergenic
1136050909 16:27649209-27649231 ATGTGGCTCCTGCCGCCCTGCGG - Intronic
1136301390 16:29336713-29336735 CTTTTGTCCCTGCCTCACTGGGG + Intergenic
1137463070 16:48683361-48683383 TTTTGGCTGCTGCCTCCCTGTGG + Intergenic
1137881129 16:52049788-52049810 CTTTGGCTCATGCCTCCTTCAGG + Intronic
1138379624 16:56590841-56590863 CTGCTGCTCCTGCTGCCCTGCGG + Exonic
1138382052 16:56609264-56609286 CTGCTGCTCCTGCTGCCCTGTGG + Exonic
1138388030 16:56649424-56649446 CTGCTGCTCCTGCTACCCTGTGG + Intronic
1138390458 16:56666947-56666969 CTGCTGCTCCTGCTGCCCTGTGG - Exonic
1138393060 16:56683959-56683981 CTGCTGCTCCTGCTGCCCTGTGG + Exonic
1138481347 16:57305414-57305436 CATTTGCTCCTGGCACCCTGTGG - Intergenic
1138537857 16:57669192-57669214 TTTTTGCTCCTGACTCGGTGAGG + Intronic
1140527721 16:75637397-75637419 CTTTTCCTCCAGGCTCACTGGGG + Intronic
1141027972 16:80565700-80565722 CTTGTTCTCCTGCCTCACAGAGG + Intergenic
1141054929 16:80805000-80805022 CATTTCATCCTTCCTCCCTGTGG - Intergenic
1141184587 16:81778607-81778629 TCTTTGCTCCTGACTCCCTTTGG + Intronic
1141212276 16:81992560-81992582 CTTTTGCTCTAGCCTCCCAGTGG - Exonic
1141569306 16:84924695-84924717 CTTCAGCTCTTGCCTCTCTGAGG + Intergenic
1142031870 16:87842557-87842579 GTTTTGCACCTGCTTCCCCGTGG + Intronic
1142063087 16:88043410-88043432 CTTTTGTCCCTGCCTCACTGGGG + Intronic
1142065280 16:88058926-88058948 CTTTTCCTTCTGCCTCCTGGTGG + Intronic
1142112665 16:88340622-88340644 CTGTTGTTCCTTCCTCCCTCTGG - Intergenic
1142413119 16:89926158-89926180 CCTGTGCTCCTCCCTCCCCGGGG + Intronic
1143300325 17:5904845-5904867 GTTTTGCTCTTTCCTTCCTGGGG - Intronic
1144539857 17:16130382-16130404 CTTTTGCTCCAGCCACCCTGTGG - Intronic
1144783831 17:17821089-17821111 CTTTTACTCCTGTCTTCATGGGG + Intronic
1145912547 17:28551088-28551110 CCTGTGCTCCTGGGTCCCTGGGG - Intronic
1147884714 17:43676834-43676856 CTATTGCTGCCACCTCCCTGGGG + Intergenic
1148517007 17:48229053-48229075 CTCTTGGTCGTGCATCCCTGAGG + Intronic
1148827812 17:50407076-50407098 CTTTCTCTCCTGTCTCTCTGTGG - Intergenic
1149221360 17:54418365-54418387 CTTTTGTACCTCCCTGCCTGTGG - Intergenic
1150235803 17:63591878-63591900 CTTTTGCTCCTGGCAGCCTGAGG + Exonic
1150555431 17:66249857-66249879 CTTTTGTTCCAGCTTCACTGAGG - Intronic
1150908234 17:69361517-69361539 CTCTTGCTCCTTCCCCACTGTGG + Intergenic
1151576211 17:74953737-74953759 GTTTTACTCCTGCTTCCCTCTGG + Intronic
1151701317 17:75744006-75744028 CACCTGCTCCTGCCACCCTGTGG + Intronic
1151746034 17:76012262-76012284 CTTTTCCTCCTTCCTCTCCGAGG + Intronic
1151837700 17:76594275-76594297 CTTTTTCTCCTGCCTTCCTGTGG + Intergenic
1152226172 17:79093933-79093955 CTCTAGCTCCTGGCTTCCTGGGG - Intronic
1152511585 17:80793445-80793467 CTGTTTGTCGTGCCTCCCTGTGG + Intronic
1152517989 17:80837292-80837314 CAGTTCCTGCTGCCTCCCTGTGG - Intronic
1153179448 18:2416507-2416529 CTTTTCTTCCTACCTCCCTCAGG - Intergenic
1153745670 18:8177056-8177078 CATTTTCTCCTGCCTTTCTGAGG + Intronic
1154059591 18:11047142-11047164 TTTCTGCACGTGCCTCCCTGGGG + Intronic
1154197924 18:12279685-12279707 CCTTTGCTGCCTCCTCCCTGAGG - Intergenic
1155864957 18:30953462-30953484 CTTGTGCTCCTGCGTGCCTTTGG - Intergenic
1156376759 18:36521664-36521686 CTTTTAGTCCTGCCTCCCTTTGG + Intronic
1157947217 18:51993703-51993725 CTTGTGTTCCTGAATCCCTGTGG - Intergenic
1158245358 18:55426273-55426295 CTCTTTCTTCTGCCTCCCTAGGG - Intronic
1158901556 18:61966622-61966644 CTGTTGCTTCTGCCGCCCTCAGG + Intergenic
1159905301 18:74084436-74084458 CCTCTGCTCCTGCCCGCCTGAGG - Intronic
1161248576 19:3268692-3268714 CTTGTGCCCCTGCCTCCCACCGG + Intronic
1161318713 19:3631364-3631386 CCTCTGCCCCTGCCTCCCCGGGG + Exonic
1161627912 19:5337849-5337871 CTTTTTTCCCTGCCTCCCAGGGG - Intronic
1162574538 19:11491341-11491363 CTATGGCTCCAGCCTCCTTGTGG - Intronic
1162806186 19:13139068-13139090 CTTTAGGACCTGCCTCTCTGAGG - Exonic
1164746576 19:30620520-30620542 CTTTTCCTCCTGCCATCCAGGGG + Intronic
1165564386 19:36711996-36712018 CTTTTGACCCTGCTTCCTTGTGG - Exonic
1166304773 19:41931491-41931513 CTGCTGCTGCAGCCTCCCTGGGG - Intergenic
1167622216 19:50566662-50566684 TCTATGCCCCTGCCTCCCTGGGG - Intronic
1168146862 19:54424484-54424506 CTCTTGCACCTGCTGCCCTGCGG - Intronic
1168247585 19:55121019-55121041 CTTTTGCTCTTGTCTTCCTGTGG - Intergenic
1168706679 19:58474289-58474311 CTTTTGCTCCTGACTCCCATGGG - Intronic
925124813 2:1446312-1446334 TATTTGCTCCTGCCTTGCTGAGG + Intronic
925753646 2:7111787-7111809 CTCTCTCTCCTGCCACCCTGTGG + Intergenic
925997862 2:9306671-9306693 CCTCTGCTCCTGGCTCGCTGAGG + Intronic
926081166 2:9987585-9987607 TTTTTCTTCTTGCCTCCCTGTGG - Intronic
926135204 2:10331365-10331387 CGTTTCCTCCTGTCTCCCCGGGG + Intronic
927243499 2:20938620-20938642 CTTTTACCCCTGCTTTCCTGTGG + Intergenic
927257646 2:21054202-21054224 CTTCTGAGCCTGCCTCACTGAGG + Intergenic
927612847 2:24559204-24559226 CTTTTGCTGCTGCCTCTGTCAGG + Intronic
928116191 2:28546571-28546593 CTCTTTCTCCTGCCACACTGTGG - Intronic
928584904 2:32749641-32749663 CATTTGCTACTGTCTGCCTGTGG + Intronic
931653301 2:64488177-64488199 CTTTTGCTCCTGCAGCCCTCGGG + Intergenic
932168200 2:69527853-69527875 TTTAAGCTTCTGCCTCCCTGAGG + Intronic
932573723 2:72951445-72951467 CTCTGTCTCCTGCCTCACTGTGG + Intronic
933246152 2:79977003-79977025 ATTTTGTTCTTTCCTCCCTGTGG + Intronic
934047916 2:88187157-88187179 CTCCTTCTCCTGCCTGCCTGAGG + Intergenic
935717732 2:105953620-105953642 CTTTTGCTCCTGCCTGCCTGTGG + Intergenic
936340482 2:111627441-111627463 CTTTTGCTCCTGCTTTGCTGTGG - Intergenic
936653424 2:114456190-114456212 TTGTTTCTCCTGCCTCACTGAGG - Intronic
936698903 2:114986441-114986463 CATTTACACCTGCTTCCCTGAGG + Intronic
938633713 2:133198205-133198227 CTTTTTCTCCTGTCTTTCTGAGG - Intronic
940322284 2:152390064-152390086 CTTCTTCTCCTGCTTTCCTGGGG - Intronic
940895869 2:159081464-159081486 CTGGTGCTCCTACCTCCCTCTGG + Intronic
943656995 2:190520551-190520573 CTTTGGCTTCTGGCTCACTGTGG + Intronic
944647071 2:201790549-201790571 GTTTTCCTCCTGCCTCTCTGGGG - Intronic
945217601 2:207451258-207451280 CTGTTCCTCCTTCCTCCCTTTGG + Intergenic
946168781 2:217881317-217881339 CTTTTTCTTCTGTGTCCCTGGGG + Intronic
946488965 2:220129429-220129451 CTGTTTCTCCTCCCTCCCTCCGG - Intergenic
947797236 2:232902110-232902132 CTCTTGCTGCAGCCGCCCTGGGG + Intronic
948326656 2:237127213-237127235 CTTGTGCTCCTGTCTGCCAGGGG + Intergenic
948379062 2:237540615-237540637 CTGTGGGTGCTGCCTCCCTGGGG - Intronic
948536719 2:238652317-238652339 CTTCTCCTCCTGGCTCCCTGTGG + Intergenic
1169077491 20:2770182-2770204 CATCTGCTCCTGCTTCCCTGTGG + Intergenic
1169125371 20:3123708-3123730 CTTTTGCCACTCCCTTCCTGTGG - Intronic
1170447901 20:16448552-16448574 CTTTTGCTTTTGCCTGGCTGAGG - Intronic
1170585809 20:17733004-17733026 TTTTCCCTCCTGTCTCCCTGTGG - Intronic
1171099135 20:22366081-22366103 CTTTGCCTCCTGCCTCCCCTCGG + Intergenic
1171207350 20:23291215-23291237 CTTTTGCCCACCCCTCCCTGCGG + Intergenic
1171431049 20:25083324-25083346 CGTTTGCTCCTCCCTCGCTGCGG - Intergenic
1171522041 20:25783536-25783558 TTTTTGCTCCTGCAGCCCTCTGG + Intronic
1171529792 20:25845481-25845503 TTTTTGCTCCTGCAGCCCTCTGG + Intronic
1171554784 20:26072347-26072369 TTTTTGCTCCTGCAGCCCTCTGG - Intergenic
1172513596 20:35517125-35517147 CCTTAGCTCCTGCCTCCCTCTGG + Exonic
1172930243 20:38581304-38581326 TTTCTGGTTCTGCCTCCCTGTGG + Exonic
1172980146 20:38935374-38935396 ACTTTGCTCCTGCCACCCTCTGG + Intronic
1173426522 20:42948110-42948132 GTTTTCCTCCTACCTCCCTGAGG + Intronic
1174482028 20:50838065-50838087 CTCGTGCTGCTGCCACCCTGGGG - Intronic
1174649697 20:52114019-52114041 CTGTTGCTCCTCCCTCCCCTGGG - Intronic
1175791865 20:61744985-61745007 CTGTTGCAGCTGCCTGCCTGAGG + Intronic
1175939992 20:62533463-62533485 CCTTGGTTTCTGCCTCCCTGAGG + Intergenic
1176085259 20:63292941-63292963 CTTTTACTCCTCACTCCCAGAGG - Intergenic
1176973052 21:15288709-15288731 CTTTTGGTTCTGCTTCTCTGAGG + Intergenic
1177571486 21:22892675-22892697 CCTCTGCTACTTCCTCCCTGGGG - Intergenic
1178409874 21:32354167-32354189 ATTCTGCTTCTGCCTCCCTGTGG - Intronic
1178589151 21:33894785-33894807 CTTTGGTTCCTGTCTGCCTGAGG - Exonic
1178730227 21:35095220-35095242 CTTTTGCTCCTGCTCTCATGAGG - Intronic
1179400127 21:41075889-41075911 CGTTGGGTCCTGCCACCCTGGGG - Intergenic
1179465198 21:41567305-41567327 CTTCAGCTGCTGCCTTCCTGTGG - Intergenic
1179994880 21:44969435-44969457 GATGTGCCCCTGCCTCCCTGCGG + Intronic
1180127574 21:45802698-45802720 CTCCTGCTCCTGCCTCCCTCAGG - Intronic
1180595494 22:16970245-16970267 CTTCCCCGCCTGCCTCCCTGGGG - Intronic
1180929245 22:19577741-19577763 CAGTTCCTCCTGCCTCCGTGGGG + Intergenic
1180968769 22:19804041-19804063 CTTCTGCTCCAGCCACCCTGTGG - Intronic
1181612957 22:24031254-24031276 ATTTTTCTCCTGCCTCTGTGGGG + Intronic
1182025303 22:27113491-27113513 CTCTCGCTCCAGCCTCCCAGTGG + Intergenic
1182280443 22:29215142-29215164 CCTTTGCTCCGCCCACCCTGGGG - Intronic
1182662226 22:31933248-31933270 CTTCTGCTTCTGCCATCCTGGGG + Intergenic
1182853038 22:33492876-33492898 ATTTCCCTCCTCCCTCCCTGTGG - Intronic
1182890829 22:33817596-33817618 CTTTTGCTGTTACCTCTCTGTGG - Intronic
1182975221 22:34617802-34617824 CTCTTGCTTCGGCCTCCCAGAGG - Intergenic
1183331702 22:37225812-37225834 CTCATGCTCCTGCCTTCCTGAGG - Exonic
1183427226 22:37746385-37746407 CTCCTGCTCCCGCCGCCCTGGGG + Intronic
1183568570 22:38634720-38634742 CCTTTGCTCCTGCTTTCCTCGGG - Intronic
1183584758 22:38746499-38746521 CTTTTGCACCTGCCAACCTCTGG - Intronic
1183725457 22:39586765-39586787 ATTCTTCTCCAGCCTCCCTGGGG - Intronic
1183832126 22:40423829-40423851 TCCTTGCTCCTGCCACCCTGGGG - Intronic
1183872275 22:40748862-40748884 TGTTTGTTCCTGCCTCCCAGTGG - Intergenic
1184103483 22:42353966-42353988 CTTGTCCTCCAGCCTCCCTAAGG + Intergenic
1184172065 22:42765696-42765718 CTCTGGCTCCTGCATCCCTGTGG + Intergenic
1184242985 22:43221197-43221219 CCTTTGCTCGTGCCTGGCTGTGG + Exonic
1184333057 22:43838097-43838119 GTTCTGTTCCTGCCTTCCTGAGG - Intronic
1184727615 22:46355908-46355930 CTGGTGCTCCTTTCTCCCTGGGG + Intronic
1184925692 22:47635393-47635415 CCTTTGGTGCTGCCTCTCTGGGG + Intergenic
1185040853 22:48503477-48503499 GTTTTGCTCTTTCCTCCATGTGG - Intronic
1185383473 22:50521111-50521133 CTCTTGCTCCTGCTGGCCTGTGG + Intronic
1185409958 22:50676723-50676745 GGTTCCCTCCTGCCTCCCTGTGG + Intergenic
949624049 3:5848283-5848305 CTTTGGTTGTTGCCTCCCTGTGG + Intergenic
950111595 3:10422151-10422173 CCCTGGCTCCTGCCTCTCTGGGG + Intronic
950572107 3:13807672-13807694 CTTGTGATCCTGCCTTCCTGTGG - Intergenic
950809844 3:15640991-15641013 CTTCTCCACCTTCCTCCCTGGGG + Intronic
951424446 3:22527483-22527505 CCTTTGATCCTGCCTCATTGGGG + Intergenic
951478769 3:23136697-23136719 CTTTTCCTCTTGCCTTCCTTGGG - Intergenic
952773197 3:37020822-37020844 CTCTTCCTGCTGCCTCCCTGGGG - Intronic
952885173 3:38007617-38007639 TGTCTGCTGCTGCCTCCCTGGGG - Exonic
952959392 3:38580102-38580124 CACATCCTCCTGCCTCCCTGTGG - Intronic
953759894 3:45678434-45678456 CCTCAGCTCCTGCCACCCTGGGG - Exonic
954372489 3:50176144-50176166 CCTTGACTCCTGGCTCCCTGGGG + Intronic
954445788 3:50546139-50546161 CTTTTGGTCCAGCCTCCCAGAGG - Intergenic
954661135 3:52227511-52227533 CTTCCACTCCTGCCTGCCTGGGG + Intergenic
954788169 3:53110365-53110387 CGTTCACTACTGCCTCCCTGTGG - Intronic
954830364 3:53416329-53416351 CTCTTTCTCCAGCTTCCCTGTGG - Intergenic
954855516 3:53640810-53640832 CTCTTTCTCCTGGCACCCTGAGG - Intronic
955044231 3:55344682-55344704 CACTTGCTCCTACCTCCCTTGGG + Intergenic
957338066 3:78858229-78858251 CTCTTGCTCCTGATTTCCTGTGG - Intronic
957646715 3:82939686-82939708 CTTTTGCTCCTGCCAGTCAGTGG - Intergenic
961563994 3:127750323-127750345 GTTTTGCTCCCGGCTCACTGGGG + Intronic
962281803 3:134057794-134057816 CTGCTTCTCCTCCCTCCCTGGGG + Intergenic
963231873 3:142916235-142916257 CTTTTCCTCATCTCTCCCTGAGG + Intergenic
963607262 3:147421759-147421781 TTTTCGCTCCCGCCTCACTGGGG - Intronic
965501228 3:169458472-169458494 CTTCTGCTCCCGAGTCCCTGGGG + Intronic
966917515 3:184593198-184593220 CTGTTCCTCCTGCCACTCTGTGG + Intronic
967077117 3:186013584-186013606 CTTTCTCTCCAGACTCCCTGGGG + Intergenic
967102165 3:186224460-186224482 CTCTTTCTCCTGTCTGCCTGCGG - Intronic
967494248 3:190124879-190124901 CTCCTGCTACTGCCTACCTGTGG - Intergenic
968640802 4:1713451-1713473 CTTTTGCACCTGCTGCCCTCAGG + Intergenic
969350271 4:6594320-6594342 CTTCTGCCTCAGCCTCCCTGAGG - Intronic
969689302 4:8695280-8695302 GATTTGCTCCTGCCTGGCTGTGG + Intergenic
969712438 4:8851775-8851797 CTCTTCCTCCTGCTTCCCAGTGG + Intronic
970454182 4:16205628-16205650 CTCTTGCACCTCCTTCCCTGTGG - Intronic
971011465 4:22441291-22441313 CTTTAGCTTCTGCCTACCAGAGG + Intronic
971082954 4:23236109-23236131 CTTCTGCTCCTGATCCCCTGTGG - Intergenic
971539785 4:27801429-27801451 ATTTTGCGCCTGCCTCCTGGAGG + Intergenic
971770017 4:30884002-30884024 CTTTTCCTCTTGCCTCCCATAGG - Intronic
971774038 4:30937451-30937473 CCTTTCCTCCTGCCTCCCTAGGG + Intronic
972075313 4:35079604-35079626 CTTTTGCTCCTGCCATTTTGTGG - Intergenic
973070873 4:45856610-45856632 CTTTTGTGCCTCCCTGCCTGTGG + Intergenic
974779412 4:66533273-66533295 CTTTTGCTTCTTCATCCCTTAGG - Intergenic
976620154 4:87119108-87119130 CCTATTCTCCTGCCTCACTGGGG + Intronic
976729156 4:88244897-88244919 CTTTTGCTCCTGCCATTCAGCGG - Intergenic
976952280 4:90848895-90848917 TTTTCTCTCCTGCCACCCTGTGG + Intronic
976984123 4:91271424-91271446 CCTTTCCTCCTGAGTCCCTGAGG + Intronic
978615308 4:110587881-110587903 CTCTTGCTCCTGCATCCTAGAGG - Intergenic
979522240 4:121681016-121681038 CTCTTTCTCCTGCCTGACTGAGG - Intronic
979963598 4:127050740-127050762 CAGTTGCTCCTGCCTATCTGTGG + Intergenic
980901539 4:138909820-138909842 CCCTTGCTGCTGCCTCTCTGAGG + Intergenic
982941923 4:161569933-161569955 TTCTTTCTCCTCCCTCCCTGAGG - Intronic
984426183 4:179589399-179589421 TTTTTTCTCCTGCTTTCCTGTGG + Intergenic
986100872 5:4609921-4609943 CTTTTGGTTCTCCCTCCCTGCGG + Intergenic
986304128 5:6502987-6503009 CCTTTGCTCTTTCCTCCCAGTGG - Intergenic
986384925 5:7224081-7224103 CTTTTGCTCATTCATTCCTGTGG + Intergenic
987381397 5:17289145-17289167 CTTTCTCTCCAGTCTCCCTGAGG - Intergenic
987962089 5:24823846-24823868 TTGTGGCCCCTGCCTCCCTGGGG - Intergenic
988435780 5:31173567-31173589 CTTTTGCTTTTGTCCCCCTGGGG + Intergenic
988555725 5:32234300-32234322 CTGTTGCTCCTACTTCACTGGGG + Intronic
989240916 5:39202257-39202279 CTTTTGGACCTGACTCCCAGGGG + Exonic
991086332 5:62651322-62651344 CTTCTCCTCCTGGCTACCTGAGG + Intergenic
992017495 5:72590567-72590589 CTTGTGCTGTAGCCTCCCTGTGG + Intergenic
992380753 5:76234722-76234744 CATTTTCCCCTGCCTCCCTCTGG + Intronic
993799351 5:92312409-92312431 CTTTCTCCTCTGCCTCCCTGTGG - Intergenic
995092878 5:108200201-108200223 TTGTAGCTTCTGCCTCCCTGTGG + Intronic
995119572 5:108521249-108521271 CTTTTACTCCAGCCAGCCTGAGG - Intergenic
996217506 5:120887333-120887355 CTTTTGCTCCTGCCTTTTGGAGG + Intergenic
997475890 5:134142265-134142287 CTGCAGCTCCTGCTTCCCTGAGG - Exonic
997845595 5:137283196-137283218 CTTTTGCCTCTACCTCCCAGTGG + Intronic
998203744 5:140145099-140145121 CTACTGCTGCTGCCTCCCAGAGG + Intergenic
998225386 5:140322760-140322782 CTTCACCTCCTGCCTCCCTGGGG - Intergenic
998456927 5:142280782-142280804 CCTTTCCTTGTGCCTCCCTGGGG + Intergenic
998505322 5:142667769-142667791 CTGTTCCTCCAGGCTCCCTGGGG + Intronic
999347788 5:150839781-150839803 CTTTGGCACCTGCCTTGCTGTGG + Intergenic
1001308239 5:170591294-170591316 CTGTGGCCCCTGCCTCCATGTGG - Intronic
1001314385 5:170632177-170632199 CCTTTGCTTCTGCCTCCAAGAGG + Intronic
1002189028 5:177469319-177469341 CTTCTCCTCCTCCCTCCCCGGGG - Intronic
1002298970 5:178247021-178247043 CTTCTGTGTCTGCCTCCCTGGGG + Intronic
1002956734 6:1872919-1872941 CTCCTGCTCCTGCAGCCCTGTGG - Intronic
1006283646 6:33076834-33076856 TTCTTCCTGCTGCCTCCCTGTGG + Intronic
1006630995 6:35429436-35429458 CTTTTCCTCCTGTTCCCCTGGGG - Intergenic
1007691864 6:43707641-43707663 CTCCTGCCCCTGCCTCGCTGTGG - Intergenic
1010420440 6:75668260-75668282 CTTTTGCTCGTGCTACCATGTGG - Intronic
1010679957 6:78787157-78787179 TTTTTGCTCCTGAGTCCTTGAGG + Intergenic
1010958166 6:82115140-82115162 CCTTTGCTCCTGCCAAACTGGGG - Intergenic
1011797735 6:90975859-90975881 CCTCTGCTCCTGCTTCCCTGTGG + Intergenic
1013350579 6:109302157-109302179 ATTTGGCTCCTGCTTCTCTGTGG + Intergenic
1017501976 6:155034051-155034073 TTTTTTTTCCTGCCTCCCTTTGG + Intronic
1018701997 6:166434543-166434565 CCTCTGCTCCTGTCTGCCTGTGG + Intronic
1018742269 6:166739069-166739091 GTTTTTCTCCACCCTCCCTGTGG - Intronic
1019477715 7:1251985-1252007 CCTTTGCCCCTGCCTGCCAGGGG - Intergenic
1020035561 7:4960941-4960963 CTTCTGGTCCTAGCTCCCTGGGG - Intergenic
1021565681 7:22014331-22014353 CCTTTGCCCCTGCCTTCCTGGGG - Intergenic
1024499234 7:50085358-50085380 CTTTTGTTCCAGCATCCCTAAGG + Intronic
1025003377 7:55336876-55336898 CTCTTGCACCTGCCTGTCTGTGG - Intergenic
1026557182 7:71418729-71418751 AATTTGCTCCCTCCTCCCTGGGG - Intronic
1026617317 7:71916963-71916985 CTTTTGTTCCTAACTCCCTGTGG - Intronic
1028094890 7:86747986-86748008 TTGTTCCTCCTGTCTCCCTGTGG + Intronic
1029209775 7:98897355-98897377 CTTTCTTTCCTGCCTCACTGTGG + Intronic
1029215568 7:98946778-98946800 CTGTTACTCCTGCCTCCCAGTGG + Intronic
1029630694 7:101748298-101748320 CTTTCTCTCCAGCCTCCGTGGGG - Intergenic
1030545525 7:110890177-110890199 CTTTTGCTCCTACGTCCTTCTGG + Intronic
1030740233 7:113100876-113100898 GTTTTCCTCCTACCTCTCTGCGG - Intergenic
1031973027 7:128077408-128077430 CTGTTGCTGCGGCCACCCTGAGG - Intronic
1032446802 7:131991194-131991216 ACTTTATTCCTGCCTCCCTGTGG - Intergenic
1032785597 7:135197123-135197145 CTCCTCCTCCTGCCTCTCTGAGG - Intronic
1032803569 7:135335462-135335484 TTGGTGCCCCTGCCTCCCTGTGG - Intergenic
1032948519 7:136880080-136880102 CAATTGCTCTTGCCTCTCTGTGG + Intronic
1033230215 7:139591483-139591505 CTCTTCCTCCTTCTTCCCTGTGG + Intronic
1034430825 7:151040454-151040476 CCCCTACTCCTGCCTCCCTGCGG + Intronic
1034438762 7:151076211-151076233 CGGTTCCTCTTGCCTCCCTGTGG + Intronic
1035516348 8:235748-235770 CAATAGCTCCTGCCTTCCTGAGG - Intronic
1036123368 8:6041473-6041495 CATGTGCTCCTGCGTCCCAGTGG + Intergenic
1036184762 8:6613596-6613618 CTTGGGCTCCTGTCTCCCCGGGG - Intronic
1036492024 8:9236531-9236553 CTTTTGTTTCTGACTCTCTGTGG + Intergenic
1037649752 8:20825570-20825592 CTGTGGCTTCTGCCTCCATGGGG + Intergenic
1038338610 8:26665078-26665100 CTTTTCCTCATGTCTCCCTCGGG + Intergenic
1038685954 8:29718718-29718740 CCTTTGCTCCGGCCTCCTTGTGG - Intergenic
1039350924 8:36762605-36762627 CTTCTGCTCCTTCCTGCCTTAGG - Intergenic
1039387153 8:37146168-37146190 CTTTTGCTGCTGTTCCCCTGTGG - Intergenic
1039408623 8:37333633-37333655 CTTTTTCTCCTGAGTCTCTGTGG - Intergenic
1039805151 8:40991443-40991465 CCTTTGCTAGTTCCTCCCTGAGG - Intergenic
1040303075 8:46198087-46198109 CTTTTGCCCAGGCCACCCTGAGG - Intergenic
1041435234 8:57831878-57831900 CTTTGTCTCCAGTCTCCCTGGGG - Intergenic
1041784001 8:61611118-61611140 CTTTTTCACCAGGCTCCCTGGGG - Intronic
1042335501 8:67626041-67626063 CTCTTTCTCCTGCCACCATGTGG + Intronic
1043562898 8:81515706-81515728 CTTTTGCTCCTGCAGCCATATGG - Intergenic
1044493007 8:92842978-92843000 CTCTTGCTCCTTCATCCCTAGGG + Intergenic
1045141051 8:99283318-99283340 CATTTCCTCTTTCCTCCCTGAGG + Intronic
1046161549 8:110373711-110373733 CTTTTCTTCCTCCCTCCCCGAGG - Intergenic
1047214577 8:122865954-122865976 TTTTTCCTCCTGGCTCCCTCTGG + Intronic
1047613345 8:126542362-126542384 CTCATCCTCCTGCCTCCCTCTGG + Intergenic
1047813946 8:128442155-128442177 CCTCTGCTCCAGCCTCCCAGGGG - Intergenic
1048000772 8:130377804-130377826 CTCTGGCTCCTGCTTCCCAGAGG + Intronic
1048399056 8:134046360-134046382 GTTTTGCTCTTGCCTGACTGTGG + Intergenic
1048558400 8:135505662-135505684 CTTTTGCTCCTCCAGCCTTGAGG - Intronic
1049128737 8:140817071-140817093 TCTTTGCCCCTTCCTCCCTGGGG - Intronic
1049372340 8:142273806-142273828 CTTTTCCTCTTGCACCCCTGAGG + Intronic
1051368952 9:16341944-16341966 CTCCTGCTCATGCCTCCCAGTGG - Intergenic
1053380206 9:37642920-37642942 TTCTTTTTCCTGCCTCCCTGTGG + Intronic
1053383298 9:37666896-37666918 CCTTTGATCCTTCCTCACTGAGG + Intronic
1055892477 9:81138112-81138134 CTTTCCCTCCAGCCTCACTGTGG - Intergenic
1056581438 9:87890013-87890035 CATTTGCTCCTGCCTTCCTTGGG - Intergenic
1057558833 9:96111425-96111447 CGCCTGCTCCTGCCTCTCTGTGG - Intronic
1057696256 9:97324847-97324869 CTCTTGGTCCTCCCTCCCTAGGG - Intronic
1057967620 9:99519396-99519418 CATTTGCTCCTGGCTGGCTGGGG + Intergenic
1058592331 9:106578249-106578271 CTTATGCTGTTGCTTCCCTGAGG + Intergenic
1059301496 9:113317253-113317275 CTTTAGCTGCTGGCTTCCTGGGG + Intronic
1060174930 9:121490638-121490660 CTCTAGCACCTGCCTCCATGCGG - Intergenic
1060234338 9:121852061-121852083 GTTCTGCCCCTGCCTGCCTGTGG + Intronic
1060235148 9:121857407-121857429 CTTTTGCTGCTCCCTGGCTGTGG + Intronic
1060791152 9:126486595-126486617 GTTCTGCTCCGGCCTGCCTGTGG + Intronic
1060922527 9:127432117-127432139 CTTTTGCTTCTGCTTTCCTCAGG + Intronic
1060950468 9:127598957-127598979 CTCTTGCACCAGCCTCCCAGGGG + Intergenic
1061916891 9:133760064-133760086 CTGCTGCTCCTGGCCCCCTGGGG - Intergenic
1062177874 9:135174359-135174381 ATCCTGCTCCTGTCTCCCTGGGG - Intergenic
1185463909 X:344336-344358 CTTTCACTCCTGCCTCCCGTTGG - Intronic
1186491294 X:9975269-9975291 CTTTTGCCTCGGCCTCCCAGAGG + Intergenic
1189442111 X:41046464-41046486 TTTTTTTTCCTGCCTTCCTGTGG + Intergenic
1190408568 X:50112004-50112026 CATTTCCTCTTACCTCCCTGAGG - Intergenic
1191181975 X:57574034-57574056 CTCTTGCTGCTGCCTCTCTCTGG - Intergenic
1191847212 X:65555861-65555883 CTTTTACCTCTGCCTCCCTAGGG + Intergenic
1191870595 X:65741788-65741810 CTTTTCCCCCAGCCTCCCTAAGG - Exonic
1195054115 X:101126328-101126350 CTTCTGGTCCTGTCTCCTTGAGG + Intronic
1196463099 X:115949368-115949390 TCTTAGCTCCTGCCTTCCTGGGG - Intergenic
1197706661 X:129639198-129639220 CTTTCGCTGGTGCCTCCCAGAGG + Intergenic
1197816994 X:130508188-130508210 TTTTTGCATCTGACTCCCTGTGG + Intergenic
1197885806 X:131217158-131217180 CTTTTGGTCCTGCTTAGCTGAGG - Intergenic
1198229901 X:134678901-134678923 CTTTTCCTCTTCTCTCCCTGTGG - Intronic
1198428521 X:136543193-136543215 CTTTCACAGCTGCCTCCCTGGGG - Intronic
1199263442 X:145802241-145802263 ATTTTGCTACTGTTTCCCTGTGG - Intergenic
1199697637 X:150354325-150354347 CTTTGACTCCCTCCTCCCTGAGG - Intergenic