ID: 1063576540

View in Genome Browser
Species Human (GRCh38)
Location 10:7266656-7266678
Sequence CAGTTTCAACAGAAGCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063576535_1063576540 18 Left 1063576535 10:7266615-7266637 CCACAGGGAGGCAGGAGCAAAAG 0: 1
1: 1
2: 6
3: 47
4: 392
Right 1063576540 10:7266656-7266678 CAGTTTCAACAGAAGCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063576540 Original CRISPR CAGTTTCAACAGAAGCCCTC TGG Intronic
No off target data available for this crispr