ID: 1063577600

View in Genome Browser
Species Human (GRCh38)
Location 10:7275695-7275717
Sequence AATCACATGGCTAAGTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063577594_1063577600 22 Left 1063577594 10:7275650-7275672 CCCCAAACACTGTAAAAATCATC 0: 1
1: 0
2: 3
3: 52
4: 1093
Right 1063577600 10:7275695-7275717 AATCACATGGCTAAGTTAAGGGG No data
1063577593_1063577600 23 Left 1063577593 10:7275649-7275671 CCCCCAAACACTGTAAAAATCAT 0: 1
1: 0
2: 1
3: 39
4: 404
Right 1063577600 10:7275695-7275717 AATCACATGGCTAAGTTAAGGGG No data
1063577595_1063577600 21 Left 1063577595 10:7275651-7275673 CCCAAACACTGTAAAAATCATCA 0: 1
1: 1
2: 0
3: 36
4: 434
Right 1063577600 10:7275695-7275717 AATCACATGGCTAAGTTAAGGGG No data
1063577596_1063577600 20 Left 1063577596 10:7275652-7275674 CCAAACACTGTAAAAATCATCAT 0: 1
1: 0
2: 4
3: 49
4: 453
Right 1063577600 10:7275695-7275717 AATCACATGGCTAAGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063577600 Original CRISPR AATCACATGGCTAAGTTAAG GGG Intronic
No off target data available for this crispr