ID: 1063579240

View in Genome Browser
Species Human (GRCh38)
Location 10:7290928-7290950
Sequence GGCTTGAAATCCAACATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063579240_1063579249 27 Left 1063579240 10:7290928-7290950 CCACTAATGTTGGATTTCAAGCC 0: 1
1: 0
2: 2
3: 9
4: 115
Right 1063579249 10:7290978-7291000 CAAAGCCGGGTCACCTCTCAGGG No data
1063579240_1063579244 13 Left 1063579240 10:7290928-7290950 CCACTAATGTTGGATTTCAAGCC 0: 1
1: 0
2: 2
3: 9
4: 115
Right 1063579244 10:7290964-7290986 ATCCACATAGAGTCCAAAGCCGG No data
1063579240_1063579248 26 Left 1063579240 10:7290928-7290950 CCACTAATGTTGGATTTCAAGCC 0: 1
1: 0
2: 2
3: 9
4: 115
Right 1063579248 10:7290977-7290999 CCAAAGCCGGGTCACCTCTCAGG No data
1063579240_1063579245 14 Left 1063579240 10:7290928-7290950 CCACTAATGTTGGATTTCAAGCC 0: 1
1: 0
2: 2
3: 9
4: 115
Right 1063579245 10:7290965-7290987 TCCACATAGAGTCCAAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063579240 Original CRISPR GGCTTGAAATCCAACATTAG TGG (reversed) Intronic
901233727 1:7656266-7656288 GGCTGGAAGTCCAAGATTAAGGG + Intronic
902437326 1:16406892-16406914 GGCTGGAAGTCCAAGATCAGGGG - Intronic
904981851 1:34510473-34510495 GTCTTATAATCCAATATTAGTGG + Intergenic
906875471 1:49533497-49533519 AGCTTCAAATACAACCTTAGGGG + Intronic
910091190 1:83465964-83465986 GGCTTGAAACCCAACTTGAATGG + Intergenic
913287907 1:117243784-117243806 CGCTTGAAACCCCACAATAGTGG + Intergenic
914349616 1:146829464-146829486 AGCAGAAAATCCAACATTAGTGG + Intergenic
915037603 1:152941876-152941898 GGCTTGAGAGACCACATTAGTGG + Intergenic
915551090 1:156634868-156634890 GCCTTGAAAGACAACATGAGGGG - Intergenic
916667501 1:166979714-166979736 GGCTTCAAATCCAACTGCAGTGG + Intronic
917488199 1:175474449-175474471 GGTTGGAAGTCCAACATCAGGGG - Intronic
919856034 1:201706754-201706776 TGTTTCAAATCCCACATTAGTGG - Intronic
923949751 1:238935908-238935930 GGCTGGAAATCCAAGGTTATGGG + Intergenic
1063579240 10:7290928-7290950 GGCTTGAAATCCAACATTAGTGG - Intronic
1064771709 10:18730197-18730219 GGCTCGAAGTCCAAGATTAAGGG + Intergenic
1066479297 10:35779900-35779922 GGCTCTAAATCCAACATGAATGG - Intergenic
1069193807 10:65523809-65523831 AGCTTGAAATCCAAGAATTGTGG + Intergenic
1071038252 10:81274240-81274262 TGCATGAAATCCAACATAAGTGG - Intergenic
1074839415 10:117334224-117334246 GGCATGAAGCCCAACATTACAGG - Intronic
1085476823 11:76794270-76794292 GGCTTTGAATCCAACAGCAGTGG + Intronic
1085873577 11:80379845-80379867 GGCTTAAAAACCAACAAAAGAGG + Intergenic
1086528149 11:87753301-87753323 GTTTTGTAATCCAACATTGGAGG + Intergenic
1091651371 12:2312741-2312763 CGGTTGAAATGCAACATTGGGGG - Intronic
1092779726 12:11974426-11974448 GGCTGGAAGTCCAAAATCAGGGG + Intergenic
1093788338 12:23217582-23217604 GGCTTGAAATGCAACATAAGAGG - Intergenic
1095789060 12:46144318-46144340 GGCTTAAACTTCAAAATTAGAGG - Intergenic
1098058596 12:66535935-66535957 GGCTTGAAATACTACATTTGAGG - Intronic
1102090278 12:110181395-110181417 GGCTTAAAATCCAATATTTGGGG + Intronic
1103524329 12:121557727-121557749 GGCTAGAAGTCCAAAATTAAGGG - Intronic
1106865009 13:33954615-33954637 GGCTGGAAGTCCAAGATTAAGGG + Intronic
1115257563 14:31419641-31419663 GGCTTGAGCTCCTACATTAAAGG - Intronic
1115358320 14:32473549-32473571 AGCTTGAAATGCCAAATTAGTGG + Intronic
1115914142 14:38291457-38291479 GTCTTGAAATAAAAAATTAGAGG - Intergenic
1116268931 14:42735540-42735562 AGCTTGAAATATTACATTAGGGG - Intergenic
1121217870 14:92262725-92262747 GGCCTGAAATCAAGCACTAGGGG - Intergenic
1126763166 15:51988191-51988213 GGTTTGAAATCCAACATCTAAGG + Intronic
1126797706 15:52273663-52273685 GGCTGGAAGTCCAAGATCAGGGG - Intronic
1128218406 15:65950323-65950345 GCCTGGAAATCCAACATTTTGGG + Intronic
1128751277 15:70151784-70151806 GGCTAGAAGTCCAAGATTAAGGG - Intergenic
1128862172 15:71083183-71083205 GGCTTTGAAGCCAGCATTAGAGG - Intergenic
1128895219 15:71366638-71366660 GATTTGAAATCCCACATAAGAGG - Intronic
1130120652 15:81044870-81044892 GGCTGGAAATCAAACAGGAGTGG - Intronic
1131320113 15:91380806-91380828 GACTTTAAATCCAACATCAAAGG - Intergenic
1132221122 15:100106251-100106273 GGCTGGAAATCCAACATCCAGGG - Intronic
1139984420 16:70886083-70886105 AGCAGAAAATCCAACATTAGTGG - Intronic
1144211172 17:13017007-13017029 GGCTTGAAAGCCGAAATGAGAGG - Intronic
1148640188 17:49181696-49181718 GGCTTGCAATCCAAGTTTACCGG - Intergenic
1151222346 17:72622458-72622480 GGATTGGAATCCAACTCTAGAGG - Intergenic
1153359915 18:4182550-4182572 GGCTTGAATTCCAACTTATGTGG - Intronic
1159104948 18:63994819-63994841 GGCTTGATAACCAGCAGTAGTGG - Intronic
1159422225 18:68236328-68236350 GATTTGAAATCCATCAATAGTGG - Intergenic
1160327052 18:77959916-77959938 GGCTTAAAATGCAATATTACAGG - Intergenic
1162361999 19:10226193-10226215 AGCCTGAAATCCAGCGTTAGTGG - Intronic
926936744 2:18093458-18093480 GGCTGGAAGTCCAACATCAAAGG - Intronic
927968105 2:27284584-27284606 GGCATGAAGTCCTACATGAGAGG + Intronic
930880082 2:56260430-56260452 TGCTTGAAATAAAACTTTAGTGG + Intronic
932700327 2:73987006-73987028 AGCTTGAAATACAACATCTGAGG - Intronic
933311531 2:80667237-80667259 TGCTTGAAATTAAACATAAGAGG + Intergenic
939490385 2:142869178-142869200 GGCTAAAAATACAAAATTAGCGG + Intergenic
942461154 2:176169724-176169746 GGCTGGAAATGCAACCTTGGAGG + Intronic
945061452 2:205912714-205912736 GGATTGAAATCTAACATTTGTGG - Intergenic
946825878 2:223677381-223677403 GGCTGGAAATCCTAGATTGGGGG + Intergenic
947005997 2:225512170-225512192 TGCTTGAGTTCCAAAATTAGAGG + Intronic
1168751342 20:284066-284088 GGCTTGAAGTGAAACACTAGGGG + Exonic
1177055565 21:16297300-16297322 GGCTGGAAATCCAACAAGAGTGG - Intergenic
1179153739 21:38831731-38831753 TGCTTGAAATTTAACATTAGGGG + Intergenic
1180097404 21:45563314-45563336 GGCATGCAATCAAAAATTAGTGG + Intergenic
1181490712 22:23259238-23259260 GGCCTGAAATCCAAGATCAAGGG + Intronic
949838325 3:8292962-8292984 GGCTTGAGTTCTAACAGTAGGGG + Intergenic
956093347 3:65691041-65691063 GGCCTGTAATCCAACATTTTGGG + Intronic
956228346 3:66985000-66985022 GGCTAGAGATCCAAGATTAATGG + Intergenic
962940729 3:140122588-140122610 GGCTGGAAATGCAATATTAATGG + Intronic
966248352 3:177833926-177833948 AGCTTCAAATCCAAAATTAGTGG + Intergenic
967907437 3:194513288-194513310 GGCCTGAAGTCCAACATTTAAGG + Intergenic
969667885 4:8572513-8572535 GGCTTGGAGTCCAACAGTGGGGG + Intronic
971005750 4:22372871-22372893 GACTTGAAATCTAACATTTCTGG + Intronic
971755124 4:30697454-30697476 GGCTCCACATCTAACATTAGGGG + Intergenic
973051066 4:45597000-45597022 GGCTAGAAATCCAAGATCAATGG - Intergenic
974642313 4:64646839-64646861 ATCTTGAATTCCCACATTAGTGG - Intergenic
975288049 4:72643263-72643285 GGCCTGAAAGCCAACATCAGCGG - Intergenic
975558737 4:75690131-75690153 GGGTTAAAAATCAACATTAGAGG + Intronic
976201265 4:82581347-82581369 GAATTGAAATACAACATTGGTGG - Intergenic
976305211 4:83553000-83553022 GGCTAGAAGTCCAAGATCAGGGG - Intronic
977398616 4:96502857-96502879 GGTTTGAAATCAAAGATGAGAGG - Intergenic
990063956 5:51689012-51689034 GGCTGGAAATCCAAGATCAAAGG - Intergenic
990853574 5:60236746-60236768 GTCTTCAAATCCAGCATTTGTGG - Intronic
992125057 5:73631466-73631488 GGCTTGAAATCCTGGGTTAGAGG - Intronic
992868184 5:80978968-80978990 GGCTAAATATCCAACAGTAGGGG - Intronic
994782241 5:104105139-104105161 GGCCTCAGTTCCAACATTAGGGG - Intergenic
995413018 5:111879714-111879736 GGCTAGAAATCCTAGATTAAGGG + Intronic
996888604 5:128389571-128389593 GGCTTGACATCCTCCTTTAGGGG - Intronic
997433004 5:133854198-133854220 CCCTTGAAATCCAACACCAGCGG - Intergenic
997865603 5:137460075-137460097 GCCTTGAAATCCAAGCTAAGAGG + Intronic
1002025029 5:176390976-176390998 GTCCTCAAATCCAACATTTGAGG - Intronic
1003816369 6:9845488-9845510 TGCATTAAATCCAACATTAAGGG + Intronic
1007242295 6:40435417-40435439 GCCTGTAAATCCAACATTTGGGG - Intronic
1008985089 6:57532862-57532884 GGCTCGAAATCCAAGATCAAAGG + Intronic
1009173123 6:60425817-60425839 GGCTTGAAATCCAAGATCAAAGG + Intergenic
1011110390 6:83831319-83831341 AGCTTGAAATCCAACATGGCAGG - Intergenic
1011810937 6:91131328-91131350 GGCTGCAAATCCAAGATTAAGGG - Intergenic
1016739514 6:147512622-147512644 GGCTTTAAATCAAACATCATTGG + Intronic
1017989877 6:159476977-159476999 GGCTGGAACTCCCAGATTAGAGG - Intergenic
1026686227 7:72512455-72512477 GGCTGGAAATCCAAGATCAAGGG - Intergenic
1027308034 7:76922434-76922456 GGCTTGAAACCCAACTTGAATGG + Intergenic
1033440512 7:141373942-141373964 GGCATGAAATCCAACTCTGGGGG + Intronic
1033869437 7:145732635-145732657 AGCTTGAAATTCAACATAACTGG - Intergenic
1034491514 7:151395603-151395625 GGCTGGGAATCCAAGATAAGGGG - Intronic
1039457637 8:37718049-37718071 GGTTTGAAATCCATGCTTAGAGG - Intergenic
1039870743 8:41543154-41543176 GGTTTTAAGTCCAATATTAGAGG - Exonic
1041709145 8:60876962-60876984 GGCTGGAAATCCAAGATCAAGGG - Intergenic
1042524281 8:69748230-69748252 GGCCTAAAATACATCATTAGTGG + Intronic
1049534957 8:143175186-143175208 GCCTTGGAATCCAGCATAAGGGG - Intergenic
1051283682 9:15471598-15471620 TGCTTAAAGTCTAACATTAGAGG + Intronic
1052100200 9:24436702-24436724 TCCTTTAAATCCAACATTGGTGG + Intergenic
1055084485 9:72300069-72300091 GGCTGGAAATCCAAGATCAAGGG - Intergenic
1055424484 9:76180339-76180361 GCCATGAAATCAAACATCAGTGG - Intronic
1058680396 9:107435563-107435585 GGATTCAAATCCAAGACTAGTGG - Intergenic
1060588437 9:124801173-124801195 GGCTTGAAGTCCAACCTGATAGG - Intronic
1187301748 X:18057667-18057689 GGCTTGAAGTCCAAGATCAATGG - Intergenic
1187671039 X:21666041-21666063 GGATTGAAATTCTACATAAGTGG - Intergenic
1187976058 X:24706542-24706564 TGGTTGAAATCCAACATCACTGG + Intronic
1187998739 X:24957924-24957946 GGCTTGAATTCCAAATATAGTGG + Intronic
1188508108 X:30905445-30905467 GGCTGGAAGTCCAAGATTAAGGG + Intronic
1189941767 X:46131019-46131041 GGCTTGAAACACAACATTAGGGG + Intergenic
1190899929 X:54661585-54661607 GACTTGAAACATAACATTAGAGG - Intergenic
1196724433 X:118883652-118883674 GGCTCCACCTCCAACATTAGGGG - Intergenic
1202198580 Y:22323479-22323501 GTCTTTAATTCCAACATTTGGGG + Intronic