ID: 1063581939

View in Genome Browser
Species Human (GRCh38)
Location 10:7316113-7316135
Sequence AACGCATGACCTCCCTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063581937_1063581939 -9 Left 1063581937 10:7316099-7316121 CCTTGAAGAGCCAAAACGCATGA 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1063581939 10:7316113-7316135 AACGCATGACCTCCCTCAACAGG No data
1063581936_1063581939 14 Left 1063581936 10:7316076-7316098 CCATGCTGAGAACAGATGGTGAA 0: 1
1: 0
2: 0
3: 18
4: 216
Right 1063581939 10:7316113-7316135 AACGCATGACCTCCCTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063581939 Original CRISPR AACGCATGACCTCCCTCAAC AGG Intronic
No off target data available for this crispr