ID: 1063591353

View in Genome Browser
Species Human (GRCh38)
Location 10:7398865-7398887
Sequence TTTTGAGTCTCATGGCGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063591353_1063591357 0 Left 1063591353 10:7398865-7398887 CCATACCGCCATGAGACTCAAAA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1063591357 10:7398888-7398910 AGTAAAGAAACTTACAAGGAAGG No data
1063591353_1063591356 -4 Left 1063591353 10:7398865-7398887 CCATACCGCCATGAGACTCAAAA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1063591356 10:7398884-7398906 AAAAAGTAAAGAAACTTACAAGG No data
1063591353_1063591358 24 Left 1063591353 10:7398865-7398887 CCATACCGCCATGAGACTCAAAA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063591353 Original CRISPR TTTTGAGTCTCATGGCGGTA TGG (reversed) Intronic
905965609 1:42092903-42092925 TTTTCAGGCTCATAGCTGTAAGG - Intergenic
912117073 1:106419604-106419626 TTCTGAGTCTCCTGGAGGTGGGG - Intergenic
914461962 1:147893065-147893087 TTTTGAGTCTCCTGTGGGTTAGG + Intergenic
915529901 1:156497441-156497463 TTCTGAGTCTCATGGCACTGTGG - Intronic
916515677 1:165514233-165514255 TTTTGAGTGGCAAGGCTGTAAGG - Intergenic
922021068 1:221705414-221705436 TTTTGAGTCTTATAGCAGTTTGG + Intronic
1063591353 10:7398865-7398887 TTTTGAGTCTCATGGCGGTATGG - Intronic
1067708465 10:48628558-48628580 TTTGGAGCCTCAAGGTGGTAGGG - Intronic
1069818860 10:71215344-71215366 TTATGAGTCTCATGGCAGAGGGG - Intronic
1073343294 10:102762466-102762488 TTTTGATTCTCATGGGATTAAGG - Intronic
1075846332 10:125547875-125547897 TTTTGAGTCTCCTAGCAGGATGG + Intergenic
1078339813 11:10490673-10490695 TCTTGTGACTCATGGGGGTAAGG + Intronic
1078976229 11:16480722-16480744 CATTGAGTCTCAGGGCTGTAAGG - Intronic
1090629729 11:128635633-128635655 ATTTGAGTCTGAAGGCAGTATGG + Intergenic
1093747665 12:22761596-22761618 TTTGGAGTCTCAATGCGATAAGG - Intergenic
1100859401 12:98788289-98788311 TTTTCAGTCTCAAGGAGGCAAGG + Intronic
1118500397 14:66356871-66356893 TTTTGTGTCTTATGGTGGGAGGG - Intergenic
1125348845 15:38746528-38746550 TTTTGATCCTCATGGCAGAATGG + Intergenic
1126034055 15:44531062-44531084 TCTTAAGACTCATGGGGGTAGGG + Intergenic
1130932107 15:88436948-88436970 GTTTGAGACTCAGGGGGGTAGGG - Intergenic
1136029426 16:27491991-27492013 TTTTGAGTCTCACGAAGGCAGGG + Intronic
1137079019 16:36020237-36020259 TTTTGAGGCTTATGGTGGAAAGG + Intergenic
1140643680 16:77006617-77006639 TGTTGAATCTCATGGAGTTAGGG - Intergenic
1141038548 16:80651802-80651824 AGTTGATTCCCATGGCGGTAGGG + Intronic
1146312401 17:31779291-31779313 TTTTGAGGCTCATGGCAGAAAGG - Intergenic
1149424215 17:56539473-56539495 TTTTGTCTCTCATGGCTCTATGG + Intergenic
1149505039 17:57187204-57187226 TTTTGAGACTCATGGGCTTAGGG - Intergenic
1157092899 18:44657516-44657538 TTTTGACTCTGCTGACGGTAGGG + Intergenic
1159018311 18:63121031-63121053 TATTGAGTATCATGCCAGTATGG - Intergenic
1159556629 18:69952573-69952595 TTTTGTGTTTCACGGAGGTAGGG - Intronic
1165481234 19:36065728-36065750 TTTGGTGTCTCAGGGCGGAAGGG + Intronic
926699644 2:15795228-15795250 GTTTGAGTCTCCTGGGGGTGGGG - Intergenic
927086003 2:19674694-19674716 TTTTGAGTGTCATGGGGCTGGGG - Intergenic
928270708 2:29852352-29852374 TTTTGAGTCTGAAGGGGTTAAGG - Intronic
929752609 2:44731374-44731396 TTTTCAGACTCCTGGCTGTAGGG - Intronic
933572381 2:84028659-84028681 TTTTGAGAATAATGGCTGTATGG + Intergenic
938642022 2:133291328-133291350 TTTAGAGGCTCCTGGAGGTAAGG + Intronic
939395034 2:141618000-141618022 TTCTGATTCTCATTGCAGTAGGG - Intronic
942293471 2:174495485-174495507 TTTTGACACTCATGGCTGGATGG - Intergenic
943655867 2:190508337-190508359 TTGTGAGGCCCATGGCTGTAGGG + Exonic
943690855 2:190868486-190868508 TTTACAGTCTCATGGCTATAGGG - Intergenic
948159889 2:235814922-235814944 TTTAGAGACTCATGGCCGCACGG + Intronic
1170855571 20:20050754-20050776 TTTTCAGTCTCATGGAGGAATGG - Intronic
1172185728 20:33029933-33029955 TTTTGAGGCTCAGGGCAGTCGGG + Intergenic
1176760987 21:10789496-10789518 CTTTGAGTCCTATGGTGGTAAGG + Intergenic
1182631017 22:31685397-31685419 TTTTGAGTGGTTTGGCGGTAGGG + Exonic
1184260380 22:43311999-43312021 TGTTGAGGCTCATCGTGGTATGG + Intronic
1185052075 22:48559257-48559279 TTTTGGGACCCATGGCGGTCGGG + Intronic
950893985 3:16431438-16431460 TTGTGAGTCTCCTGGGGATATGG - Intronic
951265057 3:20555260-20555282 TTCTGAGACTCTTGGTGGTAAGG - Intergenic
951546400 3:23830336-23830358 TTTTGTGTGTGATGGGGGTAGGG - Intronic
952844198 3:37673331-37673353 TTTTGAGTCTCACAGGGGAAAGG - Intronic
956355705 3:68390066-68390088 TGTTGAGTTCCATGGGGGTAGGG - Intronic
962924895 3:139983494-139983516 TTTGGATTCTCATGGCTTTAAGG - Intronic
963590815 3:147256184-147256206 TTTTGGGTCTCCTGGCTGCATGG + Intergenic
975478036 4:74845031-74845053 TATTGAGTGTCATTGCTGTATGG - Intergenic
979666032 4:123311939-123311961 TTTTGATTCACATGGCGAGATGG - Intronic
982573692 4:157081410-157081432 ATTTGAGTTTCATGACGGGACGG - Intronic
983934180 4:173488245-173488267 TTTTGAGTCACGTGACTGTAGGG - Intergenic
987794554 5:22609176-22609198 TTTAGAGTCTCATCTCAGTAAGG + Intronic
997244974 5:132340086-132340108 TTTTGAGTCTCATAGCCCTGTGG + Intronic
997966495 5:138361020-138361042 TTTTGAGTCTGCTGGTGGAAGGG - Intronic
1000053472 5:157581888-157581910 ATTTTAGTCTCATGGCTCTAGGG - Intergenic
1007516843 6:42419446-42419468 TTGTGAGTCGCATGGAGGTGGGG - Intronic
1025574868 7:62623833-62623855 TTTGGAGTCTCATGGAGGGCTGG - Intergenic
1041934164 8:63318340-63318362 TTCTGTGTCTCCTGGTGGTAGGG - Intergenic
1043645610 8:82514535-82514557 TTTTGTGTTTCATGAAGGTAAGG - Intergenic
1044986874 8:97763565-97763587 TTTTGAGTTTCTTGGAGGCAGGG + Intergenic
1050572286 9:6953293-6953315 TTTTGATTCTCATGGAGTAAAGG + Intronic
1052067224 9:24036856-24036878 TTTTGAGTCTCTTGCCGCTTGGG - Intergenic
1058281966 9:103127302-103127324 TTTTGAGTCTGATGGCTTGAAGG + Intergenic
1186352535 X:8754957-8754979 TGTTGAGTCCCATGGCAGGAAGG - Intergenic
1189356127 X:40311027-40311049 CTTTGGGTCTCATGGCTTTATGG - Intergenic
1192533158 X:71906927-71906949 TATTGAGTCTCATGGCAAGAGGG + Intergenic
1194766329 X:97847619-97847641 GTTGGAGTTTCTTGGCGGTATGG - Intergenic
1194956529 X:100187692-100187714 TTTTAAGTCCCATGAGGGTAAGG - Intergenic
1195378178 X:104247958-104247980 CTTTGAGTCTCAGGGTGGCAAGG + Intergenic
1195727699 X:107935222-107935244 TTATGAGTCTCATGAGGGCAGGG - Intergenic