ID: 1063591354

View in Genome Browser
Species Human (GRCh38)
Location 10:7398870-7398892
Sequence TTACTTTTTGAGTCTCATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063591354_1063591356 -9 Left 1063591354 10:7398870-7398892 CCGCCATGAGACTCAAAAAGTAA 0: 1
1: 1
2: 0
3: 16
4: 187
Right 1063591356 10:7398884-7398906 AAAAAGTAAAGAAACTTACAAGG No data
1063591354_1063591358 19 Left 1063591354 10:7398870-7398892 CCGCCATGAGACTCAAAAAGTAA 0: 1
1: 1
2: 0
3: 16
4: 187
Right 1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG No data
1063591354_1063591357 -5 Left 1063591354 10:7398870-7398892 CCGCCATGAGACTCAAAAAGTAA 0: 1
1: 1
2: 0
3: 16
4: 187
Right 1063591357 10:7398888-7398910 AGTAAAGAAACTTACAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063591354 Original CRISPR TTACTTTTTGAGTCTCATGG CGG (reversed) Intronic
903258610 1:22119078-22119100 TTCCTTTTTCAGTTTCATGGAGG + Exonic
907771731 1:57472265-57472287 TTAACTTCTGAGACTCATGGAGG + Intronic
909094321 1:71268963-71268985 CTATTTCTTGAGTCTGATGGTGG + Intergenic
909685707 1:78346239-78346261 TGACTTTTTGAGTATCTTGAAGG + Intronic
912088788 1:106044000-106044022 TTAGTTTTAGAGTATAATGGAGG - Intergenic
912521991 1:110251926-110251948 TTACTTCATGGGTCTAATGGGGG + Intronic
917254404 1:173098904-173098926 GTACTTTTGGAGTCTGATGTGGG - Intergenic
917528222 1:175808566-175808588 TTACCTGTTGAGCCTCAAGGTGG - Intergenic
918811805 1:189132311-189132333 TTCCTCTTTTAGTCTCATTGAGG + Intergenic
921389151 1:214602160-214602182 GGAATTTTTGAGTCTGATGGGGG + Intergenic
921453281 1:215335778-215335800 TTGCTTTTTGAGTCTCATGGAGG + Intergenic
921569161 1:216758224-216758246 TTTCTTTTTCAGTCTCTTGTGGG + Intronic
921590474 1:216996857-216996879 TTTCTTTTGCAGTCTCATTGGGG - Intronic
921649079 1:217655455-217655477 TTACTATTTGTCTCTCATGAGGG + Intronic
922592581 1:226788831-226788853 TTTCTTTTTGAACTTCATGGTGG + Intergenic
924910294 1:248503917-248503939 TTACTTGTTTAGTATGATGGTGG - Intergenic
924913806 1:248544121-248544143 TTACTTGTTTAGTATGATGGTGG + Intergenic
1063212364 10:3892577-3892599 TTACTTTTTGATGTTCATGTTGG + Intergenic
1063591354 10:7398870-7398892 TTACTTTTTGAGTCTCATGGCGG - Intronic
1064550179 10:16492638-16492660 TTAATTTTTGAGCCCCCTGGAGG + Intronic
1065553007 10:26887947-26887969 CTACTTTTAAAATCTCATGGAGG - Intergenic
1066229770 10:33421076-33421098 TAACCATTTGGGTCTCATGGTGG + Intergenic
1069661052 10:70123719-70123741 TTACTTCTAGGGTCTCATTGTGG + Intronic
1070352880 10:75610542-75610564 TTAATTTTATAGTCTCATCGTGG + Intronic
1070992726 10:80746532-80746554 TTACTTTGTGTCTCTCATGATGG + Intergenic
1072364178 10:94692216-94692238 TTGCTTGTTCATTCTCATGGTGG - Intronic
1074627851 10:115213183-115213205 TTACATTTTGGGTTTCATAGTGG + Intronic
1078128286 11:8590102-8590124 TTACTTTGTCATTATCATGGTGG - Intronic
1079873446 11:25829107-25829129 TTAATTTTATAGGCTCATGGTGG - Intergenic
1084313060 11:68327687-68327709 ACACTTTCTGAGTCTCATGTGGG - Intronic
1084637967 11:70405747-70405769 GTACTTTTTCAGGCTCATCGGGG - Intronic
1085924641 11:81001506-81001528 TTACATCTTAAGTTTCATGGAGG + Intergenic
1087789446 11:102391411-102391433 TTTCTGTTTTAGTCTTATGGAGG + Intergenic
1089966907 11:122660759-122660781 TTATTTTTTGAGGCTGCTGGTGG + Intronic
1093036569 12:14337275-14337297 ATAATTTTTGTGTCTCCTGGTGG - Intergenic
1093126158 12:15330875-15330897 TTTCTTTTTGAGTGTCCTGCTGG + Intronic
1093208004 12:16273766-16273788 TTACTTTTGTAATCTGATGGGGG - Intronic
1094148971 12:27260954-27260976 TTCTTTTTTGAGTCTCAGGCAGG + Intronic
1095183657 12:39176046-39176068 ATCCTTTTTGAGTAGCATGGAGG - Intergenic
1095657691 12:44689578-44689600 TTACTATTTGATTCTCTTGAGGG - Intronic
1097761477 12:63470485-63470507 TTAATAGTTGAGTCTCTTGGTGG - Intergenic
1098910666 12:76205291-76205313 TCTCTTTTGGAGTCTCATGCAGG - Intergenic
1100151490 12:91743265-91743287 TTTCTTTTTGCTTTTCATGGTGG + Intergenic
1101697157 12:107137610-107137632 ATAATTTTTGTGTCTCTTGGTGG + Intergenic
1103240837 12:119412058-119412080 TTACCTTTTGAGGCTCAGTGAGG - Intronic
1103333012 12:120167844-120167866 GTAGTTTTTGTGTCTCTTGGTGG + Intronic
1103832555 12:123791356-123791378 TCACCTTTTCAGTCTCATGCAGG + Intronic
1104310621 12:127651329-127651351 TTACTTTTTAGGTCACATGTAGG - Intergenic
1104831082 12:131751935-131751957 TTACTGTTTCTGTGTCATGGTGG + Intronic
1105225239 13:18425792-18425814 ATACTTTTTGAGTCTCTCTGAGG - Intergenic
1106150527 13:27096701-27096723 TTACTTTGTGTGTGGCATGGTGG - Intronic
1108879170 13:55087822-55087844 TTAATTTTTGGTTCTCATGAAGG + Intergenic
1110880112 13:80561306-80561328 TTACTTTATGACTTTCATAGAGG - Intergenic
1112523104 13:100116039-100116061 TTTCTGTTTCAGTCTCAAGGAGG + Intronic
1113666483 13:112145123-112145145 CTAGTTTTTGAATCACATGGTGG + Intergenic
1113851334 13:113420333-113420355 TCACTTTCTGATTCTCACGGAGG + Intergenic
1114133759 14:19822802-19822824 TGACTCTTTGGGTCTGATGGGGG - Intronic
1116496837 14:45570900-45570922 TTATTTTTAGATTCTCTTGGGGG - Intergenic
1116956474 14:50928684-50928706 TTAATTTTTGAGTCTCTTCAAGG - Intronic
1117427568 14:55616581-55616603 TTTCTTGTTTAGTCTCTTGGTGG - Exonic
1117717851 14:58599165-58599187 TGCCTTTTTTAGTCTAATGGCGG - Intergenic
1118500401 14:66356876-66356898 CTCCTTTTTGTGTCTTATGGTGG - Intergenic
1118940906 14:70336390-70336412 TTACTTTTTGACACAGATGGTGG + Intronic
1120261413 14:82189961-82189983 TCTCTTTTTGAGTCTCTGGGTGG + Intergenic
1121930759 14:97970099-97970121 TTTCTTTTTGAGGCTTATGTAGG - Intronic
1122486104 14:102081497-102081519 ATGCTTTTTGAGTTTCATGTTGG - Exonic
1123576836 15:21678397-21678419 TGACTCTTTGGGTCTGATGGGGG - Intergenic
1123613458 15:22120865-22120887 TGACTCTTTGGGTCTGATGGGGG - Intergenic
1127503172 15:59573551-59573573 TTAGTTTTTGAGTAGCAAGGAGG + Intergenic
1202985704 15_KI270727v1_random:412642-412664 TGACTCTTTGGGTCTGATGGGGG - Intergenic
1138296715 16:55892103-55892125 TTTCTTTTGAAGTCTCATAGTGG - Intronic
1144772082 17:17765528-17765550 TTACTGTGTGAGTCACACGGTGG + Intronic
1147706386 17:42427980-42428002 TTACAATTTAAATCTCATGGGGG + Intergenic
1149133045 17:53330832-53330854 TTACTTTTTCTGTCACATGCAGG + Intergenic
1149307627 17:55364355-55364377 GTACTTCTTCAGCCTCATGGAGG - Intergenic
1149388273 17:56164038-56164060 TTACTGTTTGACTCACATGGGGG - Intronic
1150822172 17:68444371-68444393 TTGCTTTTTGAGTCTTAGTGAGG - Intronic
1152623024 17:81374952-81374974 TTACCTTTTGACTCTCTTGATGG - Intergenic
1153444239 18:5154456-5154478 TTGATTTCTGAGTCTCTTGGGGG - Intronic
1154528132 18:15313730-15313752 ATACTTTTTGAGTCTCTCTGAGG + Intergenic
1158156529 18:54431675-54431697 TTTCTTTTTTAATTTCATGGTGG - Intergenic
1159114718 18:64101103-64101125 TTAGAATTTGAGTCTCATGGTGG + Intergenic
1159477827 18:68946663-68946685 TTATGTTTTGGGTATCATGGTGG + Intronic
1159556631 18:69952578-69952600 TTAATTTTTGTGTTTCACGGAGG - Intronic
1160420609 18:78741360-78741382 TTAATTTTGGAGACACATGGTGG - Intergenic
1161216879 19:3099080-3099102 TCACTTTCTGAGTCTTGTGGTGG + Intronic
1161633258 19:5370132-5370154 TTGCTTTTTGACTCTGAGGGAGG - Intergenic
1165382353 19:35490241-35490263 TTAGTTTTGGATTCTGATGGGGG - Intronic
928020942 2:27704341-27704363 TTACCTTTTAAGTCTAATAGGGG - Intergenic
930501787 2:52230382-52230404 TTTCTTTCTGAGACTCCTGGTGG + Intergenic
930610350 2:53535888-53535910 TTTTTTTTTCAGTCTCTTGGAGG - Intronic
933878432 2:86643937-86643959 TTTCTTTTTGAGACTCAGGGTGG + Intronic
936441769 2:112560344-112560366 TTTCTTTTTGCATCTCTTGGCGG + Intronic
938527230 2:132145191-132145213 ATACTTTTTGAGTCTCTCTGAGG + Intergenic
939239885 2:139543885-139543907 ATACTTTTGTAGTCTCAAGGGGG - Intergenic
940334166 2:152507747-152507769 GTACTTTTTGTGTTTCGTGGTGG + Intronic
940638042 2:156321312-156321334 TCAATTTTGGAGTCTCATGGAGG - Intergenic
941301071 2:163802071-163802093 TTACTTTGTGCATCTCATGGTGG - Intergenic
942736324 2:179118305-179118327 TTATTTTTTTAATCTCATTGTGG + Intronic
943512898 2:188848228-188848250 TTATTTCTTGACTCTCATGGTGG + Intergenic
943779757 2:191810274-191810296 TTCCTTTTAGAGTCTCTAGGGGG + Intergenic
946819197 2:223613043-223613065 TTTCTTTTTCAGTCTAATGGAGG - Intergenic
947855814 2:233323816-233323838 TTAATGTGTGAGACTCATGGGGG - Intronic
948428905 2:237906151-237906173 TGACGGTTTGAGTCTCATCGTGG - Intronic
1170855572 20:20050759-20050781 TTTTCTTTTCAGTCTCATGGAGG - Intronic
1172268816 20:33640904-33640926 TTTCTTTTTGAGTCTCACAATGG + Intronic
1176672268 21:9745517-9745539 TCATTTTGTGAGTCTCAAGGGGG - Intergenic
1176725168 21:10425707-10425729 TTTTTTTTTGAGTATGATGGTGG - Intergenic
1176769296 21:13054811-13054833 ATACTTTTTGAGTCTCTCTGAGG - Intergenic
1177313226 21:19424380-19424402 TAGCTTTTTGGGCCTCATGGGGG - Intergenic
1178215934 21:30598390-30598412 TTGCTTTTTGATTTTCATGCAGG - Intergenic
949824119 3:8146587-8146609 TGACTTTTTGATGCTCTTGGTGG - Intergenic
953138783 3:40208349-40208371 TTACTTTTTGAGTTTCCTCTTGG - Intronic
954834625 3:53454782-53454804 GTACTATTTCAGTCTCATGATGG + Intergenic
955328947 3:58031154-58031176 TTATTTCTTCAGTCCCATGGTGG + Intronic
956047853 3:65215417-65215439 TTAATTTTTGTTTCTCCTGGTGG - Intergenic
957277974 3:78113440-78113462 ATCCTTTTGGGGTCTCATGGAGG + Intergenic
957980686 3:87505997-87506019 TTACTTTGACAGTCTCATGCAGG + Intergenic
960425579 3:117503112-117503134 CTTCATTTTGAGTCTTATGGAGG + Intergenic
963417727 3:145019376-145019398 TGACTTTATGGGTCTTATGGGGG + Intergenic
966670227 3:182517957-182517979 TTACTTTCTGAATTCCATGGGGG + Intergenic
969415085 4:7052813-7052835 TTACTTTATGATTCTCAAAGAGG + Intronic
971196919 4:24478618-24478640 TTTGTTTTTGACTCTCATGGAGG + Intergenic
975631233 4:76404698-76404720 TTTATTTTTTATTCTCATGGTGG - Intronic
976956384 4:90905531-90905553 TTTCTATTTGACACTCATGGTGG - Intronic
979098174 4:116577031-116577053 TCACATTTTCAGTCTCTTGGAGG + Intergenic
979155931 4:117391285-117391307 TTAATTTTTGATTCTTATGAAGG - Intergenic
980672987 4:136033802-136033824 TTACATGTTGAGTCTCCTGAAGG + Intergenic
982051300 4:151505066-151505088 TTACTTCCTGTGTCACATGGAGG - Intronic
985811046 5:2085881-2085903 TTGCATTTTAAGTCTGATGGTGG - Intergenic
986186997 5:5453072-5453094 TTACTTTTCCATTCTTATGGAGG - Intronic
986195141 5:5531523-5531545 TTGCTTCTTTAGTTTCATGGAGG + Intergenic
987036340 5:14022625-14022647 TTACTATTTTATTGTCATGGGGG + Intergenic
987203046 5:15596757-15596779 TGTCCTTTTGAGTCTTATGGAGG - Intronic
987701311 5:21403080-21403102 TTATTCTTTGACTTTCATGGTGG - Intergenic
987798282 5:22658583-22658605 TTACTTTTTGCTTGTCTTGGGGG + Intronic
992562383 5:77965509-77965531 GTATTTTTTGAGTCTCGAGGAGG - Intergenic
993130933 5:83897285-83897307 TTACTTTTTGAATCTCATTTTGG + Intergenic
993599313 5:89901183-89901205 TTACATTTTGGACCTCATGGTGG - Intergenic
994117055 5:96072550-96072572 TTACATATTGAGTTTCAGGGAGG + Intergenic
994389017 5:99167377-99167399 TTACTTATTGACTCAGATGGTGG - Intergenic
995101105 5:108307014-108307036 TTACTTTTTGGGTTTCATGATGG - Intronic
995268763 5:110195904-110195926 TTGCTTTTTGGTTCTCATGAAGG + Intergenic
996029912 5:118693278-118693300 TTCCTTCTGGAGCCTCATGGTGG - Intergenic
996658211 5:125967074-125967096 TCACTTAGTGGGTCTCATGGTGG - Intergenic
998472888 5:142397069-142397091 TTATTTTTTGAGTCTCATTTTGG + Intergenic
1003183478 6:3811210-3811232 TTACTTCTTCATTCTCCTGGAGG - Intergenic
1004276971 6:14245340-14245362 TTTCTTTTGGAGTCTTAGGGTGG - Intergenic
1004997492 6:21207916-21207938 TTAATTTGTCATTCTCATGGAGG - Intronic
1006225985 6:32536589-32536611 ATACTTTTTGAGAGGCATGGGGG - Intergenic
1007516846 6:42419451-42419473 TAATTTTGTGAGTCGCATGGAGG - Intronic
1009476703 6:64100984-64101006 TTTTTTTTTGTGTCTCATGCTGG + Intronic
1010761665 6:79730883-79730905 GGACTTTTTGAATCTCATTGTGG + Intergenic
1011040111 6:83020824-83020846 TTAGCTTTTTAGTCTCATGAAGG + Intronic
1011975706 6:93294998-93295020 TTACTTTTTGAAACTGAGGGGGG + Intronic
1012209699 6:96504617-96504639 TTTCTTTTGGAGTCTCCAGGAGG + Intergenic
1012577465 6:100820680-100820702 TTACCTTTTCACTTTCATGGTGG - Intronic
1012890609 6:104892890-104892912 TTACTCTTTGGGTTTCATTGTGG + Intergenic
1014138277 6:117912133-117912155 TGCCTCTTTGAGTCTTATGGCGG + Intronic
1014538088 6:122640706-122640728 TTGCTTTATGTGTCTCATGTTGG - Intronic
1015233658 6:130945736-130945758 TTACTCTTTGGGTATCTTGGGGG - Intronic
1015343834 6:132132168-132132190 TTACTTTTTGAGTGTCAGCAAGG + Intergenic
1016158812 6:140849642-140849664 TTACTATATTAGACTCATGGTGG + Intergenic
1018645837 6:165947660-165947682 TTGCTTTTTGAGTTTCATTATGG + Intronic
1022467844 7:30663443-30663465 TTACTTTTTGAGGTTCAGAGAGG - Intronic
1022666556 7:32416387-32416409 TTACATTGTGAGTCTCCTGGAGG - Intergenic
1025574870 7:62623838-62623860 GGATTTTTGGAGTCTCATGGAGG - Intergenic
1029315997 7:99714551-99714573 TTACCTTTTGTGTCTCTTTGAGG + Exonic
1032818278 7:135499607-135499629 TGACTTTATGAGTGTCATAGTGG - Intronic
1036198299 8:6743232-6743254 TCACTTTTTGTTTCTCATGGTGG + Intronic
1038857480 8:31349280-31349302 TTACTTTTTGTCTCTCAGGAAGG + Intergenic
1039093584 8:33858459-33858481 TTACTCTTTCTGTCTCATTGGGG + Intergenic
1040853249 8:51923604-51923626 GTTCTTTTGAAGTCTCATGGCGG + Intergenic
1042581462 8:70283837-70283859 TTTCCTTTTGAGTGTCATGTTGG + Intronic
1043517333 8:81006761-81006783 TTACATTTTGAGTGTCACAGAGG + Intronic
1043992052 8:86767122-86767144 TTTCTATTTGAGTCTCATAGAGG - Intergenic
1044171012 8:89051251-89051273 TTAATTGTTGATTCTCTTGGAGG - Intergenic
1045935223 8:107671178-107671200 TTACTTTTTGAGAGGCCTGGGGG + Intergenic
1049051691 8:140202317-140202339 TCTGTTTTTGAGTATCATGGTGG - Intronic
1050767451 9:9152426-9152448 TTTGTTTTTAAGTCTCAAGGGGG + Intronic
1051122539 9:13767019-13767041 TTACTTTTTAATTTTCAAGGTGG - Intergenic
1051256971 9:15223827-15223849 TTTTTTTTTGAGTGTCATGTGGG - Intronic
1052226443 9:26094409-26094431 TTATTGTTTCAGTCTCATGCAGG + Intergenic
1055403825 9:75953201-75953223 TTACTTTTCCAGTCTCATCTGGG + Intronic
1055837199 9:80457349-80457371 TTATTTTTTGTGTTTCATTGTGG + Intergenic
1056414217 9:86360777-86360799 TTTCTTTTTGATTCTCAGGAAGG + Intergenic
1056415054 9:86367569-86367591 TTTCTTTTTGATTCTCAGGAAGG + Intergenic
1057615010 9:96581646-96581668 TTACTTTTTGAGTATTAGGTGGG + Intronic
1058045034 9:100349321-100349343 TTACTTTTTGAAAATCATGTTGG + Exonic
1058565251 9:106277187-106277209 TTTATTTCTGAGTCACATGGAGG + Intergenic
1058934747 9:109758816-109758838 CTACAATTTGAGTCTCATGTTGG + Intronic
1060074471 9:120579489-120579511 TTGCTTTTTGGGTCACATAGTGG - Intronic
1187083284 X:16014307-16014329 TTGGTTTTCAAGTCTCATGGAGG + Intergenic
1189205346 X:39233525-39233547 TTACTTCTTGACTCTCCTAGGGG + Intergenic
1189732755 X:44038840-44038862 TTACTTGTTGAGTTTCTTAGGGG + Intergenic
1191588302 X:62852615-62852637 ATAATTGTTGTGTCTCATGGAGG - Intergenic
1193174421 X:78375575-78375597 TTACTTTTTCAGACTCATAGCGG - Intergenic
1194743683 X:97605581-97605603 TGCCTATTTGGGTCTCATGGGGG - Intergenic
1194844325 X:98785106-98785128 TTACTTTTTGAGTAGAATGATGG - Intergenic
1195244840 X:102986256-102986278 TTACTTCTTAAGTCTTATGAGGG - Intergenic
1196711467 X:118768101-118768123 TTACTTTTTGTGTCTCCAAGGGG + Intronic
1197134330 X:123043371-123043393 TTAATTTTTGAGCCTCAAGCTGG - Intergenic
1197963236 X:132028628-132028650 TTACTTTTCCTGTCTCATGAGGG - Intergenic
1199315368 X:146370924-146370946 TTATTTTTTTGGTCTCATGATGG + Intergenic
1199576927 X:149321298-149321320 TTTCTTTTGAAGTCTCATAGTGG - Intergenic