ID: 1063591355

View in Genome Browser
Species Human (GRCh38)
Location 10:7398873-7398895
Sequence TCTTTACTTTTTGAGTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063591355_1063591357 -8 Left 1063591355 10:7398873-7398895 CCATGAGACTCAAAAAGTAAAGA 0: 1
1: 0
2: 4
3: 21
4: 335
Right 1063591357 10:7398888-7398910 AGTAAAGAAACTTACAAGGAAGG No data
1063591355_1063591358 16 Left 1063591355 10:7398873-7398895 CCATGAGACTCAAAAAGTAAAGA 0: 1
1: 0
2: 4
3: 21
4: 335
Right 1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063591355 Original CRISPR TCTTTACTTTTTGAGTCTCA TGG (reversed) Intronic
902849461 1:19142149-19142171 TCTTTACCTTTTGTCTGTCATGG + Intronic
904502302 1:30920927-30920949 ATGTTAGTTTTTGAGTCTCAAGG + Intergenic
905222177 1:36455898-36455920 TCTTCAGCTTTTGAGTCTCCTGG + Exonic
907964650 1:59317508-59317530 ACTTTACTTTTTGAGGCCAAGGG + Intronic
908263797 1:62359515-62359537 TCTTTATTTTAAGAGCCTCATGG + Intergenic
909308386 1:74112376-74112398 AGTTTACCTTTTTAGTCTCATGG - Intronic
909830320 1:80180866-80180888 GCTTTACTTTGTGAGTTTCGTGG - Intergenic
909852916 1:80491723-80491745 TCTTTAACCTTTGTGTCTCAAGG + Intergenic
910419977 1:87049145-87049167 TCGTTAATTTTTGTGTTTCAAGG + Intronic
910556266 1:88537188-88537210 TCTTGACTTTTTGAGGCACATGG - Intergenic
911817740 1:102375124-102375146 TTTTTACTGTTTTAGTGTCATGG + Intergenic
912133582 1:106632136-106632158 TCTTTCCTTTTTGTTTATCATGG + Intergenic
913051770 1:115122800-115122822 TCTTTACTCTGTCAGTCTGAAGG - Intergenic
913448781 1:118977892-118977914 TCATTACTATTTGAGTCTGATGG - Intronic
913477644 1:119253897-119253919 TCTTTCCTTTCAGAGTTTCAAGG - Intergenic
916156774 1:161858098-161858120 TCTTTTCTTTTTAAGACACAGGG - Intronic
916696694 1:167244744-167244766 TCTCTAATTTTTGGGTGTCAGGG - Intronic
918031586 1:180818653-180818675 TCTTTTATTTTTGGGACTCATGG + Intronic
918438850 1:184545572-184545594 TCTTTATTTTCCAAGTCTCAGGG + Intronic
919518083 1:198552201-198552223 TCTTTATTTTTTGACTGCCAAGG + Intergenic
919630777 1:199958483-199958505 TCTTTCTTTTTTGTGTCACAGGG - Intergenic
919827829 1:201516369-201516391 TCCTTCCTCTTTGGGTCTCAGGG - Intergenic
920149052 1:203888965-203888987 TCTTTTCTTTAGGTGTCTCAAGG - Intergenic
921447745 1:215266352-215266374 GCCTTACTTTATGAGTCACAGGG + Intergenic
921453280 1:215335775-215335797 CTTTTGCTTTTTGAGTCTCATGG + Intergenic
921630347 1:217425063-217425085 TCTTTACTTCTTCAGATTCAGGG - Intergenic
922768433 1:228168470-228168492 TCTGTCCTTTCTGTGTCTCAGGG + Intronic
923286938 1:232505418-232505440 TCTTTACAGTTTGACTCACATGG - Intronic
923916053 1:238506021-238506043 TCTTTTCTTTTTGATTTTAAAGG - Intergenic
924750823 1:246887902-246887924 TGTTAACTTTTTGAGTGTCTTGG + Intronic
1063206000 10:3831117-3831139 TGTTTACTTTTTGAGTGTGCTGG - Intergenic
1063302961 10:4868807-4868829 TCTTTAGTTTTTTAGTATGATGG + Intergenic
1063591355 10:7398873-7398895 TCTTTACTTTTTGAGTCTCATGG - Intronic
1063777939 10:9285304-9285326 TCTTTACTTTTGGAAATTCAAGG - Intergenic
1067156778 10:43788770-43788792 TCTTTACTTGTTAACTCACAAGG + Intergenic
1067547592 10:47205608-47205630 TCTTGAATTTTTGAGGCTGAAGG - Intergenic
1067703682 10:48591190-48591212 TCATTTCTTTTTGAGTCTGCGGG - Intronic
1068140915 10:53006124-53006146 TGTGTCCTTTTTGAGTTTCACGG + Intergenic
1068346403 10:55784840-55784862 TATTTACTTTTTGTGTGGCAAGG - Intergenic
1068922069 10:62495296-62495318 TCTTTTTTTGTGGAGTCTCAGGG - Intronic
1070472288 10:76793568-76793590 TCTTTACTCTTTTAGTCTCATGG + Intergenic
1070980629 10:80643583-80643605 TCTGAACTTTTTGGGTCTCTTGG + Intronic
1071364692 10:84886635-84886657 TCTTTTTTTTTTGCATCTCAGGG + Intergenic
1073774611 10:106771840-106771862 TCTTTACTCGATAAGTCTCAGGG + Intronic
1073865989 10:107804451-107804473 TGTTTACTCTTTCAATCTCAAGG - Intergenic
1073870381 10:107856305-107856327 TCGTTCCTTCTTGAGTTTCAGGG - Intergenic
1076422947 10:130344826-130344848 CTTTTATTTTTTGAGGCTCATGG + Intergenic
1077588613 11:3474075-3474097 TCTTTACTTTTTGAGTCTATTGG + Intergenic
1077839379 11:5958313-5958335 CCTTTCCTATTTGAGTCTCATGG - Intergenic
1078943781 11:16039888-16039910 TCTCAACTTTTTTGGTCTCAGGG - Intronic
1080128961 11:28770614-28770636 TCTACACTTCTGGAGTCTCAGGG - Intergenic
1080550423 11:33369660-33369682 TCTTTACTTTTTTAGAGACAGGG + Intergenic
1080975306 11:37332761-37332783 TCGTTACTTCTTGAGTATCTGGG + Intergenic
1081069901 11:38597618-38597640 TCTTTACTATCTGAGAGTCAGGG + Intergenic
1081404202 11:42677435-42677457 TTTTTACTGTTTGGGTCTCTGGG + Intergenic
1082709073 11:56530796-56530818 TGTTTAGTTTTTGAGGTTCAGGG - Intergenic
1083414358 11:62515726-62515748 TCTTTGCTTCTTGATTCTCATGG - Intronic
1084544401 11:69807510-69807532 TCTTTGCCTATTGAGTCTCTGGG - Intergenic
1086929351 11:92675429-92675451 TATTTACTTTTGGAGCCTCTTGG - Intronic
1088228578 11:107648886-107648908 TCATTATTTTTTGAGTCAAAGGG + Intronic
1091418583 12:314210-314232 TATTTCTTTTTTGAGTCTCGGGG + Intronic
1091485827 12:887171-887193 TCTTTATATTTAGCGTCTCACGG + Intronic
1093434277 12:19118014-19118036 TCTTTAATTTGTAAGTCTGAAGG + Intergenic
1093739576 12:22668091-22668113 TCTTTACTTTTTAAAGGTCAGGG + Intronic
1094723791 12:33091496-33091518 TCTTTTCATTTTGGGTCTCAGGG - Intergenic
1095573231 12:43705808-43705830 TCTTTTCTTTTTTAGTTTTAAGG - Intergenic
1096447975 12:51711983-51712005 TCTTTACTTGTTAACTCACAAGG + Intronic
1097515965 12:60606777-60606799 TCTTCCCTTTTTGAGTCCCCAGG + Intergenic
1098121962 12:67250656-67250678 TCTTTACTATTTTATTCTCTTGG - Intergenic
1098215960 12:68219826-68219848 TCTTTATTTTTTCTTTCTCATGG - Intronic
1098542467 12:71672015-71672037 TCTTTCCTTTTCAAGGCTCAGGG + Intronic
1098600042 12:72320020-72320042 TATTTATTTTTTGATTCTCCAGG + Intronic
1099240536 12:80133479-80133501 TCTTTATTTTTTGTTACTCAGGG + Intergenic
1099490114 12:83278400-83278422 TCTTTTCTTTTTGATTATTATGG - Intergenic
1101045011 12:100795636-100795658 TCTTTCCCTTCTGAGTCTCAGGG + Intronic
1102690561 12:114757274-114757296 TCTTTCATTTTTTAGACTCATGG + Intergenic
1102852604 12:116263813-116263835 TTTTTGCTTTTTGAGGATCAAGG - Intronic
1103164772 12:118761181-118761203 TATTTATTTTTTGAGTTTGAGGG + Intergenic
1104370336 12:128218686-128218708 TTTTTACTTTTTGAGACTGTTGG + Intergenic
1104586311 12:130050887-130050909 TCTTTATTTTTTGAGAAGCAGGG - Intergenic
1104784960 12:131443473-131443495 TCTTTAATTATTTAGTCCCACGG + Intergenic
1106094412 13:26630007-26630029 TATTTATTTTTTGAGTCTCAGGG + Intronic
1106934447 13:34702996-34703018 TCTTTACCTTTTGAGTAATAAGG - Intergenic
1106941948 13:34789697-34789719 TATTTTCTTTTTGAGATTCAGGG - Intergenic
1107429675 13:40329173-40329195 CATTTTCTTATTGAGTCTCATGG - Intergenic
1109332453 13:60946299-60946321 TGTCTTCTTTTTTAGTCTCATGG - Intergenic
1109372219 13:61437554-61437576 GCTTTATTCTTTAAGTCTCATGG + Intergenic
1110112402 13:71764729-71764751 TCTTTACTTTTACAATCTGAAGG + Intronic
1111344452 13:86932223-86932245 TCTTTACTTTTTTAAACTTATGG - Intergenic
1111745837 13:92268351-92268373 TCTATACTTTTTTTTTCTCATGG + Intronic
1111860515 13:93699072-93699094 TCTTTACTTTTTCAAGCTCCTGG - Intronic
1112848807 13:103677929-103677951 AATTTACTTTTTGATTTTCATGG - Intergenic
1112880377 13:104099861-104099883 TCTTTACTCTTTTATTATCAAGG - Intergenic
1113006926 13:105716491-105716513 TCTTGACTTCTTGAGTCTGCAGG + Intergenic
1113645713 13:111993929-111993951 TATTCCCTTTCTGAGTCTCAGGG - Intergenic
1114652052 14:24291422-24291444 TCTCTGCTTTTTGAGGCCCAAGG - Intronic
1115125305 14:29985771-29985793 TCTTTACCTTTGGGGTCTGAAGG + Intronic
1115207464 14:30925064-30925086 TCTTTAGTTTCTTAGTTTCAAGG + Intronic
1115934796 14:38540357-38540379 GCTTTACATTTTGAACCTCATGG + Intergenic
1118430109 14:65709666-65709688 TCTGTACTTTTTCATTCTAAGGG - Intronic
1118500402 14:66356879-66356901 TCTCTCCTTTTTGTGTCTTATGG - Intergenic
1118940277 14:70328850-70328872 TCTTTACTTTTAGAGCTTCTGGG + Intronic
1118944328 14:70370229-70370251 TTTTCACTTTGTGTGTCTCAAGG + Exonic
1119127797 14:72144159-72144181 CCTTTAATTTTTGAGAGTCAGGG - Intronic
1119255399 14:73191552-73191574 TCTTTTCTTTTTTAGTTTTAGGG + Intronic
1121089762 14:91173078-91173100 TCTTAACTTTTTGTGTGCCACGG - Intronic
1121973843 14:98384156-98384178 TATTTATTCTTTGACTCTCAAGG + Intergenic
1122175463 14:99915083-99915105 TCTCTACATTTTGAGTTTGATGG + Intronic
1125093765 15:35827439-35827461 TCTTAACTTCTTCTGTCTCAAGG - Intergenic
1125822451 15:42643916-42643938 TCTTTATTTTTTAACACTCAGGG + Intronic
1127027810 15:54827316-54827338 TCTTTTCTTTTTGATTACCATGG + Intergenic
1127863525 15:63013601-63013623 TCTTTCCTTATTGGGGCTCAGGG - Intergenic
1129129766 15:73483316-73483338 TCTTCAGCTTTTGAGTCTCTTGG + Intronic
1130740586 15:86595593-86595615 TCATTCCTTTCTGAGTCTGAGGG + Intronic
1133061496 16:3177758-3177780 TCTTTACCTATAGAGTCTCCAGG + Intergenic
1133837493 16:9379754-9379776 TCTTCATTTTTTGAGACTCCAGG - Intergenic
1134308195 16:13052504-13052526 CCTTTAGTTTTTGAGATTCATGG - Intronic
1137379592 16:47984988-47985010 ACTTTACCTTTTAAGTCTAAAGG - Intergenic
1137709530 16:50556518-50556540 TCCTTACTTGTTAAGTCACATGG + Intronic
1138972461 16:62162045-62162067 TGTTTTATTTTTGTGTCTCAGGG + Intergenic
1140292708 16:73676572-73676594 TATTTTCTTTTTGATTCTCTGGG - Intergenic
1140586293 16:76296328-76296350 TCTTTACTATTTAAGTCAAATGG - Intronic
1141268542 16:82518780-82518802 TCTTGACTTTGTGTGTCTCCTGG + Intergenic
1141781710 16:86166747-86166769 TTTTCAGTTTATGAGTCTCAAGG + Intergenic
1143549342 17:7620082-7620104 TCTTTACTTTTTTAGAGACAGGG - Intronic
1144486608 17:15670789-15670811 TCTTTGCTTATTCAGTATCACGG - Intronic
1144914412 17:18711498-18711520 TCTTTGCTTATTCAGTATCACGG + Intronic
1145930399 17:28681241-28681263 TCTCTTCTTTTTCAGGCTCAAGG + Exonic
1148215542 17:45832225-45832247 GCTTTGTTTTTTGAGACTCATGG - Intronic
1149358173 17:55865891-55865913 TCTTTACTTTCTGAGCTCCAGGG - Intergenic
1149388276 17:56164041-56164063 TTTTTACTGTTTGACTCACATGG - Intronic
1150272342 17:63874469-63874491 TCTTGAAGATTTGAGTCTCAGGG + Intronic
1153288633 18:3479247-3479269 TGTTTAGTTGTTGAGACTCATGG + Intergenic
1153992804 18:10414978-10415000 TCTTTGCTTTTCAAATCTCAGGG + Intergenic
1154103793 18:11502122-11502144 TCTTCATTTTTAGAGTCCCATGG + Intergenic
1155775583 18:29756530-29756552 ACTTTTCTTTTTGTGTCTCCAGG + Intergenic
1155903247 18:31417337-31417359 TCTTTACTGCTTAAGACTCAGGG + Intergenic
1157351573 18:46892171-46892193 TCTGTACTTTTTAAGTCTCAGGG + Intronic
1158572284 18:58606779-58606801 CCTTTACTTATTGAGTTTCCTGG + Intronic
1159865777 18:73702985-73703007 TCTTTACTGTCACAGTCTCATGG + Intergenic
1160420610 18:78741363-78741385 TCTTTAATTTTGGAGACACATGG - Intergenic
1164382126 19:27744384-27744406 TTTTTTTTTTTTGAGACTCATGG - Intergenic
1165204026 19:34168738-34168760 TCTTTACTTTATGAGGCTAGGGG + Intergenic
925014420 2:510959-510981 TCCTCACATTTTGAGTTTCATGG + Intergenic
926659644 2:15449994-15450016 CATTTACTTTTTGATTCTCCAGG - Intronic
928853276 2:35774308-35774330 ACTTTACATCTTGAGTATCAAGG + Intergenic
929230015 2:39549709-39549731 TCTTTACCTTTTCATTCTCCAGG + Intergenic
929647134 2:43638324-43638346 TCTTTAGTTTTTGCCTCTTAAGG - Intronic
930082690 2:47466636-47466658 TCTTTTCTTCTTGATTATCAAGG + Exonic
930144464 2:47987268-47987290 TTTTTTCTCTTTGAGTCTTAAGG - Intergenic
930218337 2:48720226-48720248 TGGTTACTCTTTGAGTCTCGTGG + Intronic
930610051 2:53532332-53532354 TCTTTTCCTTTCAAGTCTCAGGG - Intergenic
931052633 2:58430718-58430740 TGTTTACTTTTTGGTTCCCAAGG + Intergenic
931215308 2:60236641-60236663 TCTTACCTTAATGAGTCTCAAGG + Intergenic
931984396 2:67727627-67727649 TCTTTTCTTTTTGAGGGGCAGGG + Intergenic
933143977 2:78828594-78828616 TCTTAACCTTTTGGGGCTCATGG - Intergenic
933878431 2:86643934-86643956 TTTTTTCTTTTTGAGACTCAGGG + Intronic
934890129 2:98060379-98060401 TCTTTACATTTTGAGTAAGAAGG - Intergenic
935873751 2:107483187-107483209 TCTTTACTCTTTTTTTCTCATGG + Intergenic
935946821 2:108294208-108294230 TCCTTCCTTTCTGAGCCTCAGGG + Exonic
939151396 2:138477246-138477268 TCTTTACTTTTGTATTCTCCAGG - Intergenic
939843294 2:147214464-147214486 TTTTTTCATTTTGAGTCTTAGGG - Intergenic
940070858 2:149686252-149686274 TCTTTACTGTTTTAATGTCAGGG - Intergenic
940744182 2:157548760-157548782 TTGTTATTTTTTGAGTTTCATGG - Intronic
941855732 2:170228453-170228475 CCTTCACTTTTTGAGTACCAAGG + Intronic
942561114 2:177219849-177219871 TCTTTACTTGTTAACTCACAAGG - Exonic
943417513 2:187627371-187627393 TCTTTAATTTGTGACTCACATGG - Intergenic
943418165 2:187635190-187635212 TCTTTTTTTTTTGAATCTAAGGG - Intergenic
943441061 2:187929452-187929474 TCTTTTCTGTTTGAGTATCCAGG + Intergenic
943537154 2:189166890-189166912 TCTTTTCTTTCCGAGCCTCATGG - Intronic
943978933 2:194521824-194521846 TCTTGACGTTTTCAGGCTCATGG + Intergenic
944927006 2:204475800-204475822 ACTTTACTTTTTCAGTCTTGAGG + Intergenic
945813529 2:214576224-214576246 TTTTCACTTTTAGAGTCTAAGGG + Exonic
946819198 2:223613046-223613068 TCTTTTCTTTTTCAGTCTAATGG - Intergenic
946914405 2:224502389-224502411 TCTTTAGCTTTGGAGTCTGATGG - Intronic
947022702 2:225699063-225699085 TCTGTGCTTTTTAAGTTTCAAGG + Intergenic
1169706533 20:8512400-8512422 TCTTTACTTTCTGTGTATGAGGG + Intronic
1170363676 20:15576317-15576339 GCTTTATATTTTGAGTTTCAAGG + Intronic
1170468733 20:16647241-16647263 TCCTTACTTGTTGTGTGTCAGGG - Intergenic
1172759063 20:37309295-37309317 TCCTCACCTTCTGAGTCTCATGG + Intronic
1172945444 20:38684137-38684159 TATTTACTTTTTGTGTGTGATGG - Intergenic
1175490001 20:59373771-59373793 TCTTCACTGTTTGAGCTTCACGG + Intergenic
1176672271 21:9745520-9745542 GCTTCATTTTGTGAGTCTCAAGG - Intergenic
1177313229 21:19424383-19424405 TCTTAGCTTTTTGGGCCTCATGG - Intergenic
1177439100 21:21096697-21096719 TCTTTACTCTTTTAATATCATGG + Intronic
1177810997 21:25924887-25924909 TCTTTCCTTTTTGATTCTTTTGG + Intronic
1177877857 21:26656477-26656499 TCTTTTCTCTTTAAGCCTCAGGG - Intergenic
1178889699 21:36510748-36510770 TCTTTCCCTTTTGAATCCCAAGG + Intronic
1179125278 21:38584739-38584761 TCTTTCCTATTTGATTTTCATGG - Intronic
1179771032 21:43616983-43617005 TCTTTCCTCATAGAGTCTCAAGG - Intronic
1182860724 22:33557019-33557041 TCTTTTCTTTGTATGTCTCAGGG - Intronic
949326519 3:2871616-2871638 TCTTTATTTTTTGAGAAACAAGG + Intronic
949366692 3:3289496-3289518 TCTGTACTTCATGAGTCTAAAGG - Intergenic
951152322 3:19305936-19305958 TTTTTATTTTTTGATTTTCAAGG - Intronic
951495252 3:23318065-23318087 TCCCTACTTTTTGATTCTAATGG + Intronic
952012373 3:28914847-28914869 TCTTTACTTTTTAACTCCAAAGG + Intergenic
952230975 3:31430601-31430623 TCTTAACTTTTTGGCTCCCATGG - Intergenic
952585236 3:34884706-34884728 TTTTTTCTTTTTTAATCTCATGG + Intergenic
953517850 3:43613793-43613815 TTTGTACCTTTTGACTCTCATGG - Intronic
954291209 3:49650980-49651002 TCTTTACTTTAGGAGTCGCAGGG - Exonic
954319089 3:49818854-49818876 TGTTTAGTTTTTGTGTCTCTAGG + Intergenic
955763159 3:62311085-62311107 ACGTTACTTTTTGAGTAACATGG + Intergenic
956932298 3:74058403-74058425 TCTTTATTTGTTGAATCTAATGG - Intergenic
957606958 3:82412479-82412501 TCTTTACATTTTGAGGTCCACGG - Intergenic
957627641 3:82674618-82674640 TCTTTACTTGTTAAGTAGCAAGG - Intergenic
957661270 3:83156575-83156597 ACTTTATTTTTTAAGTTTCAAGG - Intergenic
957910732 3:86617964-86617986 TCTTTTCATTTTGAGGCTCTTGG + Intergenic
958501662 3:94918553-94918575 TCTTTATTTATTGAGTTTAAGGG + Intergenic
958911917 3:100003751-100003773 TCTTGACTTTTAGCATCTCAAGG - Intronic
959193704 3:103149382-103149404 TCTTTATTTTTTGAAACACATGG - Intergenic
959766036 3:110029634-110029656 TCTTTTCTTTATAACTCTCATGG + Intergenic
959793463 3:110393257-110393279 TCTTTATTTTTTGAGGGTCTGGG + Intergenic
960049512 3:113226520-113226542 TCTTTACTTCCTGACTTTCAAGG - Intronic
960321017 3:116236269-116236291 TTTTTATTTTTTGAGTTTTATGG - Intronic
960882983 3:122364759-122364781 TCTTTCCTTTATGAGTCTCTGGG - Intronic
962048268 3:131784547-131784569 CCTTCAGTTTTTGAATCTCATGG - Intronic
962339682 3:134571305-134571327 TCTTTACCTTCTGTGTGTCAGGG + Intronic
963208390 3:142660187-142660209 TTTTTACGTTGTTAGTCTCATGG - Intronic
964301876 3:155296803-155296825 GCTTTCCATTTTGAGCCTCAAGG - Intergenic
965058397 3:163751153-163751175 TTTTAACTTTTAGATTCTCAGGG - Intergenic
966051829 3:175626657-175626679 TCTCTACTTTTTGACTCCCATGG + Intronic
969992085 4:11275125-11275147 TCTTGCCTTTTCGGGTCTCATGG + Intergenic
970033065 4:11699806-11699828 TCTTATCTCTCTGAGTCTCAGGG - Intergenic
970098787 4:12496476-12496498 TCTTTATTTTTTTAGACTTATGG - Intergenic
970327879 4:14946743-14946765 TCTTTACTTTCTAAGTCTTTTGG - Intergenic
970506721 4:16738323-16738345 TCTTCATTATTTGAGTCTCAGGG - Intronic
970574056 4:17410594-17410616 TCTCTATTTTTTGAGTCTATTGG - Intergenic
971677067 4:29645653-29645675 ACTTTAAAGTTTGAGTCTCATGG - Intergenic
971709153 4:30089078-30089100 TTATTTGTTTTTGAGTCTCATGG + Intergenic
971718190 4:30208919-30208941 TATTTATTTTTTGAGTCAAAAGG - Intergenic
973003292 4:44978503-44978525 TTTCTATTTTTTGAATCTCAGGG - Intergenic
975860104 4:78668228-78668250 ACTTTATTCTTCGAGTCTCAAGG - Intergenic
976119105 4:81760629-81760651 TATTTACTTTTGTATTCTCAGGG - Intronic
977222037 4:94349443-94349465 ACTTTACTTTTTGACATTCATGG - Intergenic
977486406 4:97652417-97652439 TCTTTATTTTTTGAATCTTGAGG - Intronic
977580332 4:98717973-98717995 TCTTTCCATTTTCAGCCTCAGGG + Intergenic
978625429 4:110679865-110679887 TCTTTACTTTTAGACACTAATGG + Intergenic
979190827 4:117856375-117856397 TCTTTACTGTTTCAGTGGCATGG - Intergenic
979568713 4:122188942-122188964 TTTTTCCTTTTTGAGTATCGCGG + Intronic
979759145 4:124378145-124378167 TTTTCACTTTTTCAGACTCAGGG - Intergenic
980636849 4:135517079-135517101 TCTTTTCTTTTTCAGTCAAATGG - Intergenic
981486607 4:145293357-145293379 TTTTTACTTTTTGTGTTTCTTGG - Intergenic
982220911 4:153124415-153124437 GGTTTACATTTTGAGTCTCAGGG + Intergenic
983005551 4:162480218-162480240 TCTTCACTTTTTGATTTTCTGGG + Intergenic
983743928 4:171170352-171170374 TCCTTCCTTTTTGAGTTTCACGG - Intergenic
983768435 4:171517588-171517610 TCTTTGCTTGTTGAGTGTAATGG + Intergenic
984178295 4:176448154-176448176 TCTTAACTTTTTAAGGCTGAAGG + Intergenic
984218149 4:176940578-176940600 TGTTTATTTTGTGTGTCTCATGG + Intergenic
984834484 4:184007131-184007153 TATTTAATTTTTGAGTCGCATGG - Intronic
985919830 5:2961543-2961565 TCTTTGCTTCTGGAGTCTCCAGG - Intergenic
986195140 5:5531520-5531542 TCTTTGCTTCTTTAGTTTCATGG + Intergenic
986395256 5:7322849-7322871 TATTAACTTTTTGTGTCACACGG + Intergenic
986439824 5:7770610-7770632 TCTTTACTTTGAGTGACTCATGG + Intronic
987280418 5:16408066-16408088 TCTTAAATTTTTGTGTCTAATGG - Intergenic
988171602 5:27664210-27664232 TCTATATTTGTTGAGGCTCAAGG + Intergenic
988575714 5:32422238-32422260 TCATTCCTTCTTGAGTCTCATGG - Intronic
989308462 5:39984921-39984943 TCTTTTCCTTTTGAAGCTCAGGG - Intergenic
989482457 5:41947847-41947869 TCCCTACTTCTTGAGCCTCAAGG - Intergenic
989823305 5:45822163-45822185 TCTTTTCTTTTTAAATCTCCAGG + Intergenic
990877282 5:60499892-60499914 TTTTTACTTGCTGATTCTCAAGG + Intronic
992427867 5:76676890-76676912 TTTTGACTTTTTAAGTTTCAGGG + Intronic
993194852 5:84728672-84728694 ACTTTACTTCCTGAATCTCATGG - Intergenic
993593700 5:89826805-89826827 TCTGTACTGTTTGAGCTTCAGGG + Intergenic
994118301 5:96085577-96085599 TCCTCACTTTTTGACTTTCAAGG - Intergenic
994236379 5:97368442-97368464 TCTCTATTTTTTGAGACTGAGGG - Intergenic
994801427 5:104381735-104381757 TATTTACTTTTTCACTCACAGGG - Intergenic
995029239 5:107461170-107461192 TTTTTTATTTTTGAGTTTCAAGG - Intronic
995205594 5:109476091-109476113 TCTTTTCTTTTAGAATTTCAAGG - Intergenic
995291222 5:110456857-110456879 TAGTTACTTTTTTAATCTCATGG - Intronic
995580614 5:113597487-113597509 ATTTTCCTTTTTGGGTCTCATGG - Intergenic
995730446 5:115234672-115234694 TCTTTTTGTTTTGAGTCTGAGGG - Intronic
996705485 5:126493401-126493423 TATTGCCTTTTTGAGACTCATGG - Exonic
996827781 5:127704642-127704664 TATTTAATTTTTGAGGCTTATGG - Intergenic
997198081 5:131992944-131992966 TCTTAACTCTCTGAGCCTCAGGG - Intronic
997367089 5:133332906-133332928 TCATTTCTTTTGGAGGCTCATGG + Intronic
997621376 5:135298888-135298910 TGTTTTCTTCTTGAGTTTCAAGG + Intronic
998198303 5:140095914-140095936 TTTTTTTTTTTTGAGTCTCACGG - Intergenic
1001693515 5:173651219-173651241 TCTTTACTTGGTTAATCTCATGG + Intergenic
1004276972 6:14245343-14245365 TCTTTTCTTTTGGAGTCTTAGGG - Intergenic
1004792390 6:19041347-19041369 TCTTGAGTTATTGAGTCTTAAGG - Intergenic
1004989303 6:21119001-21119023 TATTTACTTTTTAATTCTTATGG + Intronic
1007217959 6:40255696-40255718 TCTTTAGTTTCTGAATCTTAGGG - Intergenic
1008073355 6:47119813-47119835 TCTTTCTCTTTTGACTCTCAGGG - Intergenic
1008375458 6:50786302-50786324 TTTATAATTTTTGAGTCTCTGGG - Intergenic
1008637278 6:53423478-53423500 TCTTTCCATTTTGACTATCAGGG - Intergenic
1009288752 6:61857151-61857173 TCTTTTCTTTTTAAGATTCATGG + Intronic
1010084613 6:71902434-71902456 ACTCTTCTTTTTGTGTCTCATGG - Intronic
1011975703 6:93294995-93295017 TGTTTACTTTTTGAAACTGAGGG + Intronic
1012123908 6:95402135-95402157 TCCTTATTTTCTGATTCTCAGGG + Intergenic
1012707288 6:102547866-102547888 TCTTTTTTTTTTAAATCTCAGGG + Intergenic
1013214031 6:108011118-108011140 TCTTTTCTTTAAGAATCTCATGG - Intergenic
1013720655 6:113024073-113024095 TTTTTTCTTATTGAGTTTCAAGG - Intergenic
1014235767 6:118952775-118952797 TCTCTAATTTTTGATTCTTATGG - Intergenic
1014828430 6:126073425-126073447 TTTTTAATTTTTAAGTGTCAGGG + Intergenic
1014846271 6:126281366-126281388 TCTTCACCCTTTGAGGCTCAGGG - Intergenic
1017292406 6:152755045-152755067 TCTTTAATTTTTCAGTGTCTTGG + Intronic
1017329384 6:153177892-153177914 CCTTTACTTTTACATTCTCAGGG + Intergenic
1018164545 6:161080859-161080881 CCTTTACTTTTTGTGTTTTAAGG + Exonic
1018641273 6:165906815-165906837 TCTTTACTTTTTGCAACCCAGGG - Intronic
1020504710 7:8969938-8969960 TCTTTCCTTTTTGATTATCATGG - Intergenic
1021552497 7:21886442-21886464 TCTTTTGATTGTGAGTCTCATGG + Intronic
1022056826 7:26745328-26745350 TCTTTACTTTTTGGAGTTCAGGG - Intronic
1024283588 7:47738626-47738648 TCTTTGGTTTGTGAGGCTCATGG - Intronic
1024699268 7:51889569-51889591 TTTTTCCTTCATGAGTCTCAAGG - Intergenic
1024700028 7:51896810-51896832 TTTTTCCTTCATGAGTCTCAAGG - Intergenic
1025150677 7:56544200-56544222 TCTTTATTTTTTGTGTTTGAAGG - Intergenic
1026219041 7:68375909-68375931 TCTTTGCTTTTGGAGGCCCATGG + Intergenic
1028657417 7:93225707-93225729 TCTTTATCTTTTGAGTTTAAAGG - Intronic
1028825397 7:95266942-95266964 TCTTTACTTTTTACATGTCAGGG - Intronic
1029987424 7:104934803-104934825 TCTTTACTTTTGGAATCAGAAGG + Intergenic
1030081092 7:105778690-105778712 TCTACTCTTTGTGAGTCTCATGG + Intronic
1030657871 7:112187956-112187978 TATTCAATTTTTGAGTCACATGG - Intronic
1032103933 7:129008490-129008512 TATTTTCTTTCTGAGTTTCAGGG - Intronic
1032178015 7:129648794-129648816 TCTTTGCTTTTTCATTGTCATGG + Intronic
1032243612 7:130187678-130187700 TCTATAATTTTTAAATCTCAGGG - Intronic
1033320726 7:140337283-140337305 TTTCTACTTTTTCATTCTCATGG - Exonic
1034309491 7:150074396-150074418 TCTTTGCTAGTGGAGTCTCACGG + Intergenic
1034797366 7:154026245-154026267 TCTTTGCTAGTGGAGTCTCACGG - Intronic
1037512702 8:19599763-19599785 TCCTTACTTTTATAGACTCAGGG + Intronic
1037538279 8:19848036-19848058 TCTTCACTGTGTGAATCTCAAGG + Intronic
1039103903 8:33970177-33970199 TCATTACATTTTGAGTGCCATGG + Intergenic
1039174697 8:34790487-34790509 TCTATTCTTTGAGAGTCTCATGG - Intergenic
1039764181 8:40610722-40610744 TCTTTTTTTTTACAGTCTCAAGG - Intronic
1040061650 8:43108544-43108566 TCTTTGCTTTTTCAGAGTCAGGG - Intronic
1040704428 8:50108841-50108863 GGTTTACTTTTGGAGTCTGAAGG + Intronic
1041996638 8:64069382-64069404 TCTTTACTCTTTGAATATAATGG + Intergenic
1042074075 8:64968696-64968718 TCTTTCCTGTGTTAGTCTCATGG - Intergenic
1043254835 8:78121798-78121820 TCTATACTTCTTGACTCTTAAGG - Intergenic
1043856640 8:85272820-85272842 TCTTTTCTTTTTGTTTCTGAAGG + Intronic
1043972029 8:86540826-86540848 GCTTTAGTTTTAGAGTATCAGGG + Intronic
1044250973 8:90003425-90003447 TTTTTAAATTTTGAGTCCCAGGG - Intronic
1044643523 8:94412825-94412847 TCTTTATTTTTAGATTCTCTGGG - Intronic
1045713467 8:105014205-105014227 TCTTTTCTTTTTTAATCTCTTGG + Intronic
1047705550 8:127495788-127495810 TCTAAACACTTTGAGTCTCAAGG - Intergenic
1050627414 9:7519807-7519829 TCTTTACTCTTAGACTCTCCTGG - Intergenic
1051415285 9:16833335-16833357 TCTTTACTTTTTGACGATCCTGG - Intronic
1051585843 9:18725940-18725962 TCTTTTATTTTGGTGTCTCAGGG - Intronic
1051865238 9:21673128-21673150 TCTTAACACTTTGAGTCTCAGGG - Intergenic
1052111913 9:24596186-24596208 TCTTTACTTTTTGAGGGATACGG + Intergenic
1053191602 9:36075543-36075565 TCTATACTTTTTGACATTCATGG + Intronic
1054870760 9:70045310-70045332 TCTATACTGTTTGGGTCCCAAGG + Intronic
1056513083 9:87324143-87324165 ACTTTTCTCTCTGAGTCTCAAGG + Intergenic
1056925009 9:90826960-90826982 GCTTGACTTTTTCAGTCTCCTGG + Intronic
1058785792 9:108385525-108385547 TATTCACTTTTTTAGTCTCTGGG + Intergenic
1185670783 X:1807706-1807728 TCTTTTCTCACTGAGTCTCAGGG - Intergenic
1186888881 X:13940522-13940544 TCCTCACTTTGTGAGTATCATGG + Intergenic
1188172205 X:26941361-26941383 TCTTCTCTTTTGGAGTCCCAGGG + Intergenic
1188732342 X:33665555-33665577 TCTTTACTTTTTCCATCTCCTGG - Intergenic
1189593623 X:42541683-42541705 TCTCTACTTATTGAGCCCCAGGG + Intergenic
1189866781 X:45338662-45338684 TATTTATTTTTTATGTCTCATGG - Intergenic
1192334011 X:70202417-70202439 TCTTATCTTTTTGATCCTCACGG - Intronic
1192569062 X:72187624-72187646 TTTTTACTTTTTTAGTGACAGGG - Intronic
1194408058 X:93522404-93522426 TCTTTACCTTCTGATTCTGAAGG - Intergenic
1196023265 X:111012492-111012514 TGTTTTCTTTTTGTTTCTCAAGG - Intronic
1196721278 X:118856454-118856476 TCTTTTCCCTTTGAATCTCAGGG + Intergenic
1197707198 X:129642673-129642695 TCTTGACTTTTTGAGCCATATGG - Intergenic
1198684152 X:139210013-139210035 TCCTTACAACTTGAGTCTCAGGG - Intronic
1199118479 X:144021327-144021349 TGTTTACATTTTGAGGCTCCTGG + Intergenic
1199275461 X:145936993-145937015 TCTTTTCCTTTCAAGTCTCAGGG + Intergenic
1199462380 X:148098853-148098875 TCTTCTCTTTTTGGTTCTCAAGG + Intergenic
1200131307 X:153848649-153848671 TTCTGACTTTTTAAGTCTCATGG + Intergenic