ID: 1063591358

View in Genome Browser
Species Human (GRCh38)
Location 10:7398912-7398934
Sequence TTCTGTAAGCCAGACATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063591353_1063591358 24 Left 1063591353 10:7398865-7398887 CCATACCGCCATGAGACTCAAAA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG No data
1063591354_1063591358 19 Left 1063591354 10:7398870-7398892 CCGCCATGAGACTCAAAAAGTAA 0: 1
1: 1
2: 0
3: 16
4: 187
Right 1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG No data
1063591355_1063591358 16 Left 1063591355 10:7398873-7398895 CCATGAGACTCAAAAAGTAAAGA 0: 1
1: 0
2: 4
3: 21
4: 335
Right 1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063591358 Original CRISPR TTCTGTAAGCCAGACATGCA TGG Intronic
No off target data available for this crispr