ID: 1063592567

View in Genome Browser
Species Human (GRCh38)
Location 10:7408211-7408233
Sequence TCCCGGGGCCGGCTTTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063592567_1063592581 26 Left 1063592567 10:7408211-7408233 CCATGGGAAAGCCGGCCCCGGGA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1063592581 10:7408260-7408282 AGCCACGGACGCGTCCTGGCCGG No data
1063592567_1063592579 11 Left 1063592567 10:7408211-7408233 CCATGGGAAAGCCGGCCCCGGGA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1063592579 10:7408245-7408267 AACGCAGGCTGGAGGAGCCACGG No data
1063592567_1063592575 0 Left 1063592567 10:7408211-7408233 CCATGGGAAAGCCGGCCCCGGGA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1063592575 10:7408234-7408256 GGGCGCGCCCAAACGCAGGCTGG No data
1063592567_1063592576 3 Left 1063592567 10:7408211-7408233 CCATGGGAAAGCCGGCCCCGGGA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1063592576 10:7408237-7408259 CGCGCCCAAACGCAGGCTGGAGG No data
1063592567_1063592574 -4 Left 1063592567 10:7408211-7408233 CCATGGGAAAGCCGGCCCCGGGA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1063592574 10:7408230-7408252 GGGAGGGCGCGCCCAAACGCAGG No data
1063592567_1063592580 22 Left 1063592567 10:7408211-7408233 CCATGGGAAAGCCGGCCCCGGGA 0: 1
1: 0
2: 1
3: 7
4: 105
Right 1063592580 10:7408256-7408278 GAGGAGCCACGGACGCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063592567 Original CRISPR TCCCGGGGCCGGCTTTCCCA TGG (reversed) Intronic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
912417703 1:109521351-109521373 TCCCAGGACCGCCTCTCCCAAGG + Intergenic
915633230 1:157168081-157168103 TCTCTGGGCCGTCTTTCCTAAGG - Intergenic
920008219 1:202848961-202848983 TTCCTGGGCCGGCTTTCTCACGG - Intergenic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
922726439 1:227925102-227925124 TCCCGGGGCTGCCCTTTCCAGGG + Intronic
1063592567 10:7408211-7408233 TCCCGGGGCCGGCTTTCCCATGG - Intronic
1065307565 10:24383452-24383474 AGCTGGGGCCGGCTTGCCCAAGG + Intronic
1065726925 10:28676635-28676657 TCGCGGGGCTGCCCTTCCCAAGG - Intergenic
1067833121 10:49621633-49621655 ACCCAGGGCTGGCTTTTCCAAGG + Intronic
1068955292 10:62815394-62815416 TCCCGGGGTCGGCTCTGCCCAGG + Intronic
1070748503 10:78949835-78949857 TCCAGGGGCTGGTTTTTCCATGG - Intergenic
1072700874 10:97640720-97640742 TCCCGGAGCCGGCTGTCTGAGGG + Exonic
1078655159 11:13231884-13231906 TCCCGATGCAGGCTTCCCCATGG + Intergenic
1079717591 11:23767819-23767841 TGACGGGGCCAGTTTTCCCAAGG + Intergenic
1081711023 11:45215457-45215479 TCCCAGGGCCTTCTCTCCCAAGG + Intronic
1083959754 11:66007955-66007977 TCCCTGAGCAGACTTTCCCAGGG - Intergenic
1089626657 11:119755265-119755287 TCCCCAGGCCGGCTTTGTCAAGG - Intergenic
1090228074 11:125083503-125083525 TCCCGTGGCCACCTTTCCCCTGG - Intronic
1091823075 12:3490971-3490993 GCCCGGCGCCGGCTTTCTCTGGG + Intronic
1092046232 12:5433220-5433242 ACCCGGGCCCGGCCATCCCAGGG + Intronic
1103362419 12:120361894-120361916 CCCCGGGGCCGGCGTTGCCATGG - Intronic
1103705336 12:122868215-122868237 CCCAGGGGCCGGCGTTCACAGGG + Intronic
1103876404 12:124130941-124130963 CCCCTGGGCTGGCTTTCACAGGG - Intronic
1105256152 13:18745069-18745091 TCCCAGGTCCCGCTTTTCCAAGG - Intergenic
1106269423 13:28138936-28138958 ACCCGTGGCCGGCTTTCCGCCGG + Exonic
1113830331 13:113290624-113290646 TGCTGGGGCCGGCTCTCCCCCGG + Intergenic
1113869087 13:113547100-113547122 TCCCAGGGCAGGCTTTTCCCCGG + Intronic
1120213450 14:81657116-81657138 TCCCATGGCCGTCTTTTCCAAGG + Intergenic
1127103385 15:55588699-55588721 TACCGGGCCCAGCTTTCGCAAGG + Intronic
1128424090 15:67521714-67521736 TCCCGGCGCCGGCTTCGCCTGGG + Intronic
1132371618 15:101303318-101303340 TGCCGGCTCCAGCTTTCCCAAGG + Intronic
1132861230 16:2072753-2072775 TTCCTGGGCCTGCGTTCCCAGGG + Intronic
1133316545 16:4888072-4888094 TCCCGAGGCCGCCTGGCCCATGG + Intronic
1139505497 16:67396320-67396342 TTCCCGGGCCTGCTTTCCCCAGG - Intronic
1140376254 16:74447761-74447783 TCCCGCTGCCGGCTTTCCGGAGG + Intergenic
1142008082 16:87699778-87699800 TCCCGGGGACCGCTGGCCCATGG - Intronic
1145904717 17:28509784-28509806 GGCCGGGGCAGGCTTTCTCAGGG + Intronic
1147565887 17:41536275-41536297 TCCAGGGGCCAGCTTCCCCGAGG + Intergenic
1150251291 17:63706103-63706125 TCCCTGGGTCTGTTTTCCCAAGG + Intronic
1151907141 17:77056113-77056135 TCCCCGGCCCGGCTTTCCGGGGG - Intergenic
1152715928 17:81900681-81900703 TCCCAGGGCCACCTTTCCCTAGG - Intronic
1154434882 18:14335609-14335631 TCCCAGGTCCCGCTTTTCCAGGG + Intergenic
1158724788 18:59960928-59960950 TCCCTGGGAAGCCTTTCCCAAGG + Intergenic
1159551593 18:69901111-69901133 TCCCGTGGGCTGCTTTCCCATGG - Intronic
1160227655 18:77023752-77023774 TCCCAGGGCCAGCCTCCCCAGGG - Intronic
1160955203 19:1688143-1688165 TATAGGGGCCGGCTTTCCCAGGG + Intergenic
1160955719 19:1690920-1690942 TGCTGTGGCCGGCTTTCTCATGG - Intergenic
1164706639 19:30324952-30324974 TCCCTGGGCCTCCTTTCCCTAGG - Intronic
1166078041 19:40425447-40425469 TGCCCAGGCCGGCTTTCCCCCGG + Intronic
1168471729 19:56645734-56645756 TCCCAGGCCCGGCTCTCCCGAGG - Exonic
928369441 2:30730624-30730646 TCCCTGGGGAGGCTCTCCCAAGG + Intronic
928418909 2:31122164-31122186 TCCAGTGGCCGGCCTTCCTAGGG - Intronic
933972641 2:87482654-87482676 TCCCGGAGCGTGCTTTGCCAGGG + Intergenic
936321078 2:111467559-111467581 TCCCGGAGCGTGCTTTGCCAGGG - Intergenic
937125596 2:119473371-119473393 TCCCAGGGCCTCCTCTCCCAGGG + Intronic
944414923 2:199471104-199471126 TCCTGGGTCCGGGTATCCCAGGG + Intronic
948711432 2:239827861-239827883 TACCTGGTCCGGTTTTCCCACGG - Intergenic
1171882901 20:30631334-30631356 TCCCAGGTCCTGCTTTTCCAGGG - Intergenic
1173891385 20:46513615-46513637 CCCCCGGGCCGCCTTTCCCGGGG + Intergenic
1175394724 20:58650482-58650504 GCCCCGGGCCGGGTTTTCCACGG - Intergenic
1176842154 21:13850093-13850115 TCCCAGGTCCCGCTTTTCCAGGG - Intergenic
1179975399 21:44862716-44862738 CCCCTGGGCCTTCTTTCCCAGGG + Intronic
1182690569 22:32158849-32158871 GCCCATAGCCGGCTTTCCCAGGG - Intronic
1184613149 22:45618769-45618791 TCCCGGGGACTCCCTTCCCAAGG - Intergenic
1184884597 22:47334905-47334927 CCCCTGGGCCAGCTTTTCCAGGG + Intergenic
1185346578 22:50313233-50313255 TCCCAGGACAGCCTTTCCCAGGG + Intronic
952430391 3:33218413-33218435 TCCCGCCGCTGGCTTTCCTAAGG - Intronic
961260104 3:125595363-125595385 TCCCGGGGCCGCCTCTCCCAGGG + Intergenic
961939950 3:130626701-130626723 TTCCTTGGCCAGCTTTCCCAAGG + Intronic
967915664 3:194576362-194576384 TACCTGGACCGGCTGTCCCATGG - Intergenic
968323454 3:197791567-197791589 TCCCGGCGCCGGGTCTCCGACGG - Intronic
968488786 4:878754-878776 TCCCGTGGCTGGCGTTCCCGTGG + Intronic
969431449 4:7157191-7157213 TCCCAGGACAAGCTTTCCCATGG - Intergenic
969609096 4:8217059-8217081 TTCCGGGGCCGCCTCTCCCTGGG - Exonic
973366582 4:49213738-49213760 TCCCAGGTCCTGCTTTTCCAGGG - Intergenic
973394028 4:49578661-49578683 TCCCAGGTCCCGCTTTTCCAGGG + Intergenic
978495589 4:109356434-109356456 TCCCGGGGCAGGCTTTGGAAGGG - Intergenic
1202764091 4_GL000008v2_random:136275-136297 TCCCTGGTCCCGCTTTTCCAGGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986307808 5:6528678-6528700 TGCCGAGGCCCTCTTTCCCAGGG - Intergenic
989578204 5:43008269-43008291 TCCCCGGGCTGGCTGTCTCACGG - Intergenic
996048874 5:118909515-118909537 TCCCAGGGCTGGGTTGCCCATGG - Intronic
998491132 5:142547299-142547321 TCCTGAGGCTGGCTTTACCAAGG + Intergenic
1002634991 5:180602894-180602916 TCCCGGGGCCAGCACTTCCATGG - Exonic
1002898532 6:1392820-1392842 TCCCGCGGCCGGCCTTCCCTGGG + Intronic
1005009725 6:21323916-21323938 TCCCGGGGCTTGTTTCCCCATGG - Intergenic
1006521193 6:34572184-34572206 TCTCGGCGCCGTCTTTCCCTGGG + Intergenic
1007225225 6:40308904-40308926 TCTCAGGACAGGCTTTCCCAGGG - Intergenic
1007573850 6:42911898-42911920 TCCCGGCCCTTGCTTTCCCAGGG - Intergenic
1007635567 6:43297947-43297969 GCCTGGGGCCAGCTCTCCCAGGG - Intronic
1015496936 6:133891835-133891857 TCCCGGGGCCCGCTCCCCCCGGG - Exonic
1018774082 6:166998459-166998481 TCCGGGGGCTGGTTTTGCCAAGG + Intergenic
1020098137 7:5379829-5379851 CCTTGGGGCCGGCCTTCCCAGGG + Intronic
1020127581 7:5541610-5541632 TCCCGGGGCCTGCCTGCCCAAGG + Intronic
1020157819 7:5741189-5741211 TCCCAGGGCCCGCTTTTCCAAGG - Exonic
1022804037 7:33804096-33804118 TCCTGGGTCCTGCATTCCCAGGG + Intergenic
1024943322 7:54784312-54784334 GCCTGGGGCTGGCTTTCGCAGGG - Intergenic
1026847789 7:73707354-73707376 CCCCGGGGCGGGCATTCTCAGGG - Intronic
1028713720 7:93940066-93940088 TCCCGGGGCTTACTTTCTCAAGG + Intergenic
1035622010 8:1042184-1042206 TGCCTTGTCCGGCTTTCCCAGGG + Intergenic
1035628699 8:1092405-1092427 TCCCGGGGCTGGCTTGCCTGTGG + Intergenic
1036429609 8:8677785-8677807 TCTCCGGGCTGGTTTTCCCAGGG - Intergenic
1036961878 8:13253682-13253704 TCCTGGAGCCTGCTTTCCCCAGG + Intronic
1040929032 8:52714645-52714667 TCCCGGTGCGTACTTTCCCAAGG + Intronic
1045511924 8:102818308-102818330 TCACAGGGACGGCTTGCCCAAGG + Intergenic
1049387787 8:142353096-142353118 TCCCGGGGCTGCCTTCTCCAGGG + Intronic
1049555184 8:143278068-143278090 GCCTGGGGCCGTCTTCCCCAAGG - Intergenic
1053122295 9:35556162-35556184 ACCCGGGGCAGGCTCTGCCATGG + Intronic
1062577438 9:137215236-137215258 CCCCGGTCCCAGCTTTCCCAGGG - Intronic
1189214429 X:39311076-39311098 TCAAGGGGCCTCCTTTCCCAGGG - Intergenic
1189223698 X:39395196-39395218 TTCCAGGGCAGCCTTTCCCAAGG + Intergenic
1199736847 X:150693489-150693511 TCCCGACGGCGGCTTCCCCAAGG + Exonic
1200049531 X:153421535-153421557 TCCCAGGGCCGGTGCTCCCAGGG - Exonic