ID: 1063594393

View in Genome Browser
Species Human (GRCh38)
Location 10:7420640-7420662
Sequence AAACCCTGCTTCCCAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063594393_1063594398 20 Left 1063594393 10:7420640-7420662 CCTATCTTTGGGAAGCAGGGTTT No data
Right 1063594398 10:7420683-7420705 AATGAGATTATGGAGTAGGCTGG No data
1063594393_1063594397 16 Left 1063594393 10:7420640-7420662 CCTATCTTTGGGAAGCAGGGTTT No data
Right 1063594397 10:7420679-7420701 CCGAAATGAGATTATGGAGTAGG No data
1063594393_1063594394 10 Left 1063594393 10:7420640-7420662 CCTATCTTTGGGAAGCAGGGTTT No data
Right 1063594394 10:7420673-7420695 CAGCCACCGAAATGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063594393 Original CRISPR AAACCCTGCTTCCCAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr