ID: 1063594393 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:7420640-7420662 |
Sequence | AAACCCTGCTTCCCAAAGAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1063594393_1063594398 | 20 | Left | 1063594393 | 10:7420640-7420662 | CCTATCTTTGGGAAGCAGGGTTT | No data | ||
Right | 1063594398 | 10:7420683-7420705 | AATGAGATTATGGAGTAGGCTGG | No data | ||||
1063594393_1063594394 | 10 | Left | 1063594393 | 10:7420640-7420662 | CCTATCTTTGGGAAGCAGGGTTT | No data | ||
Right | 1063594394 | 10:7420673-7420695 | CAGCCACCGAAATGAGATTATGG | No data | ||||
1063594393_1063594397 | 16 | Left | 1063594393 | 10:7420640-7420662 | CCTATCTTTGGGAAGCAGGGTTT | No data | ||
Right | 1063594397 | 10:7420679-7420701 | CCGAAATGAGATTATGGAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1063594393 | Original CRISPR | AAACCCTGCTTCCCAAAGAT AGG (reversed) | Intergenic | ||