ID: 1063597146

View in Genome Browser
Species Human (GRCh38)
Location 10:7445759-7445781
Sequence CTGTTGTTCTAGAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063597146_1063597151 23 Left 1063597146 10:7445759-7445781 CCTTTTTTCTTCTAGAACAACAG 0: 1
1: 0
2: 2
3: 50
4: 390
Right 1063597151 10:7445805-7445827 GTTCATTGATACTTTTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063597146 Original CRISPR CTGTTGTTCTAGAAGAAAAA AGG (reversed) Intergenic
901092450 1:6651039-6651061 CTGTCGTTCTAGAAGGGACAGGG + Intronic
902396203 1:16133599-16133621 CAGTTGTTCTGGAAGGAGAAGGG + Exonic
902842144 1:19081566-19081588 CTCGGGTTCTAGAAGAAAAGCGG + Exonic
902890430 1:19439394-19439416 CTTTTGTTCTTGAAGAACCACGG + Intronic
903028775 1:20448147-20448169 CTGGTGTTCCAGAAGCCAAAAGG - Intergenic
906422563 1:45683098-45683120 CTGTTGGTCTAAAAGATGAAAGG - Intronic
906888567 1:49681355-49681377 ACATTGTTCTAGAAGAAAAGGGG + Intronic
907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG + Intronic
907853887 1:58282596-58282618 CCTTTGTTCTAAAAAAAAAAAGG + Intronic
908364460 1:63404331-63404353 CTGTTGCTTTATAAGAGAAATGG + Intronic
908632212 1:66121572-66121594 CTGTTGTTCCAAAAGGAAAATGG + Intronic
908671238 1:66549946-66549968 CTGTTGTTCCAGAAGGAAGCAGG + Intronic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909512613 1:76471865-76471887 CTGTTGTTAAAAAAAAAAAAGGG - Intronic
909836303 1:80259840-80259862 CTTTAATTCAAGAAGAAAAATGG + Intergenic
910238113 1:85056975-85056997 CTGTTTTTCTAGTGGAAATAGGG + Intronic
911786654 1:101958391-101958413 CTGTTCTACTAGGAGAAAATAGG + Intronic
911888614 1:103337752-103337774 TTTGTGTTCTAGAAGAAAAAAGG - Intergenic
912443651 1:109716997-109717019 CTGTTCTTCTATATGAGAAACGG + Intronic
913970860 1:143415509-143415531 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914065236 1:144241120-144241142 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914113915 1:144725234-144725256 CTAAAGTTCTAGAAGAAAAAAGG + Intergenic
914561540 1:148824633-148824655 GTCTTGTTCCAGAAGAAGAAAGG - Intronic
914611292 1:149305575-149305597 GTCTTGTTCCAGAAGAAGAAAGG + Intergenic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
917189506 1:172399917-172399939 CTGTTGTTAAAAAAAAAAAAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
919278858 1:195459805-195459827 CTGTTGTTGCAGAAGCAACAGGG + Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920974042 1:210768954-210768976 TTGTTGTTCTAAAAGAATTATGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
923768133 1:236911983-236912005 CTAATGTTCTACAAAAAAAATGG - Intergenic
924075059 1:240325036-240325058 CTGTGGTTGTAGAATGAAAAGGG + Intronic
924145192 1:241067165-241067187 GTGTTGTAATAGAAGTAAAAAGG - Intronic
924663403 1:246044119-246044141 CTGTTGAATTAGAAGAAAACTGG - Intronic
924683376 1:246260731-246260753 CTTTTTTTCAAGAAGGAAAATGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063990798 10:11560155-11560177 CTGTTATTATAGAAGACAATGGG - Intronic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1064865156 10:19871176-19871198 CTGTTCTTTAGGAAGAAAAATGG - Intronic
1065658967 10:27985250-27985272 TTGTTGTACTAGAAGACAAGTGG - Intronic
1066288140 10:33988518-33988540 CAGTTGGTCTGGAAGAAAAGAGG - Intergenic
1066446078 10:35485001-35485023 CTGATGTTCCAGAAGAGGAAAGG - Intronic
1067253611 10:44612095-44612117 TTAGTGTTCTAGAAGAGAAAGGG + Intergenic
1068143771 10:53039527-53039549 CTGTTGTTTTAGTAGAGAAGGGG - Intergenic
1069246921 10:66218197-66218219 CTACTGTTCTAGAAAAAAACAGG - Intronic
1069843828 10:71356952-71356974 CTGTTGTTTTAGTAGAGACAGGG + Intronic
1071836715 10:89425457-89425479 CTGTTTTTCAGAAAGAAAAAGGG + Intergenic
1072988814 10:100169463-100169485 TAGTTTTTCAAGAAGAAAAATGG + Intronic
1073810519 10:107147669-107147691 CTCTTGGTATAGAAGATAAATGG - Intronic
1073835169 10:107432993-107433015 GTGTTGTTTTTGAAGAAGAAAGG - Intergenic
1074325108 10:112443249-112443271 CTCTTGTCCTACAAGAACAAGGG - Intronic
1074679631 10:115891290-115891312 ATAGTGTTCTGGAAGAAAAAGGG + Intronic
1074720685 10:116262668-116262690 CTATTGTTCTACAACAAAAATGG + Intronic
1075230262 10:120670452-120670474 CATTTGTTTTAGAAGACAAATGG - Intergenic
1075250187 10:120861955-120861977 CTGATGCTTGAGAAGAAAAAGGG + Intronic
1075327513 10:121546210-121546232 CTGTTGTTTAAGAAGAGAAATGG + Intronic
1075600413 10:123763538-123763560 CTTTTGATCTAAAAAAAAAAAGG + Intronic
1075885709 10:125897037-125897059 CTGACATTTTAGAAGAAAAATGG - Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076199125 10:128544341-128544363 GTGCTGTTTTAAAAGAAAAAAGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1076630454 10:131849140-131849162 CTCTTGTTCTAGAATGAACAAGG + Intergenic
1078376260 11:10795861-10795883 GTATTTTTCTAGAAGAAAATAGG + Intergenic
1078470887 11:11585728-11585750 CTGGTTTGATAGAAGAAAAATGG - Intronic
1081414577 11:42798948-42798970 CTAAAGTTCTAGAAGAAAACCGG - Intergenic
1085731974 11:79007724-79007746 CTATCCTTCAAGAAGAAAAAGGG - Intronic
1085852262 11:80135819-80135841 ATGTTGGTATAGAAGATAAAAGG - Intergenic
1086021078 11:82230318-82230340 CAGTAGTATTAGAAGAAAAATGG + Intergenic
1086065826 11:82743439-82743461 CTGTTGTGTAAGAATAAAAATGG - Intergenic
1086211048 11:84319222-84319244 CTATTGATCTAAAATAAAAAGGG - Intronic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1088319653 11:108542263-108542285 CTGTAAGTCTAGAAAAAAAATGG + Intronic
1088461455 11:110087853-110087875 CTGTTGTTTTAAAAGGAAACTGG - Intergenic
1088588795 11:111383190-111383212 CTGCTGATCAACAAGAAAAAGGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088992445 11:114965483-114965505 CTTTGGTTTTACAAGAAAAAAGG - Intergenic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1090148603 11:124357275-124357297 CATCTTTTCTAGAAGAAAAAAGG + Intergenic
1090598348 11:128343237-128343259 CTGTTGTTCTAGTTAATAAAAGG + Intergenic
1091212155 11:133871315-133871337 TTATAGGTCTAGAAGAAAAAAGG - Intergenic
1091416830 12:295217-295239 CTGGTGTCCTACAAGAAGAAAGG + Intronic
1093062937 12:14626165-14626187 CTGTATTTCTAGTAGAGAAAGGG - Intronic
1093076847 12:14767965-14767987 CTATTTTTCTAGGAGAGAAAGGG - Intergenic
1093161778 12:15755343-15755365 CTGTTGTTGGAGGAGAAAAGGGG + Intronic
1093312970 12:17614777-17614799 TTAATGTTTTAGAAGAAAAATGG - Intergenic
1093316661 12:17659792-17659814 CTGTTTTTTTATATGAAAAATGG - Intergenic
1093854553 12:24084729-24084751 CTGGAGTTCTAGAATAAAATGGG - Intergenic
1093860485 12:24160346-24160368 CTGATGTACTAAAAGAAGAATGG + Intergenic
1094086975 12:26604499-26604521 CTGCTGTTTTACAAGAAACAGGG - Intronic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1095077369 12:37947548-37947570 CTGTTGTTCTAGAATCTGAAAGG - Intergenic
1095169345 12:39015493-39015515 TTGTTGTACTAAAAGAAAAGAGG + Intergenic
1096112820 12:49039351-49039373 CTCTTGTCCTAGAAGAGACAAGG + Exonic
1096269034 12:50149025-50149047 CTACTGTTTTAGAAAAAAAATGG - Intronic
1096272035 12:50173063-50173085 CTGTTGGTAAAGCAGAAAAAGGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1099566124 12:84248719-84248741 CTGTTGTTGGAAAAGAAAAAAGG - Intergenic
1099648190 12:85388046-85388068 CTGTTGTTCTAGTTTAAATATGG - Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1100910043 12:99349563-99349585 AAGTTGTTATAAAAGAAAAAGGG + Intronic
1101263806 12:103063683-103063705 TTGTAGGTCTAGAAGAAAACAGG - Intergenic
1101587038 12:106094112-106094134 CTGTTGATTTAAAAAAAAAAAGG + Intronic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1104357033 12:128095959-128095981 CTTTAGTTCTGGAAGAAAACAGG - Intergenic
1105331854 13:19424968-19424990 GTGTTGAACCAGAAGAAAAATGG + Exonic
1105390463 13:19972761-19972783 CAGTTGGTATAGAAGAATAACGG - Intronic
1105897500 13:24728627-24728649 CAGTAAATCTAGAAGAAAAATGG + Intergenic
1106284243 13:28305395-28305417 CTGTAGTTTTAGTAGAGAAAGGG + Intronic
1107573646 13:41691874-41691896 CTGGTGTTCTACAAAGAAAAAGG - Exonic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108301734 13:49084232-49084254 CTGTTGTTAAAGAAACAAAATGG - Intronic
1108645769 13:52426059-52426081 CTGATGGTCTATAATAAAAAAGG + Exonic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1108905269 13:55462595-55462617 GTGTTATTCTTGAAGCAAAAGGG + Intergenic
1109052946 13:57507920-57507942 CTGTTGTTCTGATAGAAAATTGG - Intergenic
1110154394 13:72296165-72296187 CTATTCTGCTAAAAGAAAAATGG - Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110427993 13:75391138-75391160 CTGATGTTGTAGAAGAGAGAGGG - Intronic
1110581198 13:77129596-77129618 CTGCTGTTTTATAATAAAAATGG + Intronic
1112223573 13:97515174-97515196 CTTTAATTCAAGAAGAAAAACGG - Intergenic
1112953132 13:105027639-105027661 CCTTTTTTATAGAAGAAAAATGG - Intergenic
1115140622 14:30167297-30167319 CTGTATTACTAGAAAAAAAATGG - Intronic
1115291025 14:31772874-31772896 CTTTCTTTCTAAAAGAAAAAAGG - Intronic
1115760513 14:36576338-36576360 ATGTTTTTCTGGAAGAAGAATGG + Intergenic
1115814085 14:37143937-37143959 CTGTTTTCCTAGAATAAAATGGG + Intronic
1116215025 14:42004926-42004948 CTGTGGTTTTAGGAGAAATAAGG - Intergenic
1117091484 14:52255184-52255206 TTTGTGTTCTAGAAGCAAAAAGG - Intergenic
1118464895 14:66022184-66022206 CTGTTCTTTGAGAAGAAAGAGGG - Intergenic
1120078130 14:80183422-80183444 ATGTTTTTCAAGAAGAAAAAAGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1120562903 14:86018608-86018630 TCATTGTTCTAGAAGAAAAGAGG + Intergenic
1120705062 14:87736982-87737004 CTTTTTTTCTAAAAGAAACAGGG + Intergenic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1121808587 14:96857226-96857248 CTGTGGAACTAGAAGAAAACAGG + Intronic
1122042016 14:98994921-98994943 ATTTCGTTCTAGAAGAAAACAGG + Intergenic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1202872364 14_GL000225v1_random:176904-176926 CTGGCATTTTAGAAGAAAAATGG + Intergenic
1124803408 15:32857347-32857369 CTGGATCTCTAGAAGAAAAATGG - Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126821858 15:52512211-52512233 ATATTGTTATAGTAGAAAAATGG + Intronic
1126891091 15:53205076-53205098 GTGATTTTCTAGAAGAATAATGG + Intergenic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1127295585 15:57606015-57606037 CTAGTGTTCTATAAAAAAAAGGG - Intronic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1130570895 15:85042660-85042682 CTTTGGTTCTAGAACAAAGAAGG - Intronic
1131691167 15:94829494-94829516 CTGGTGTTATAGAAGATATAGGG - Intergenic
1131929436 15:97423620-97423642 CTGTAGTTTTGGCAGAAAAATGG + Intergenic
1132366876 15:101264262-101264284 CTGTAGTTGTAGGAGAGAAATGG + Intergenic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1138124267 16:54425991-54426013 ATGTTGTTCAACAAGAAAAAGGG - Intergenic
1138437089 16:57008462-57008484 GTGTTCTTTTAGAATAAAAATGG - Intronic
1139907061 16:70373491-70373513 CTGTTTTTGTAAAAGAAAAATGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143688760 17:8542191-8542213 CTCTTGTTCTAGGATAAACATGG + Exonic
1143961538 17:10725263-10725285 GTGTTGTCCTAAAACAAAAAGGG - Intronic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1144478038 17:15605747-15605769 CTGATGTTTTCCAAGAAAAAAGG - Intronic
1146207833 17:30920336-30920358 CCGTTGCTTTAGATGAAAAAAGG - Intronic
1147126435 17:38372804-38372826 CTGTTGTAATAAAAGAAAAAAGG + Intronic
1147369843 17:39984771-39984793 CTGTTGTTCTAGGAGAGAGAAGG + Intronic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1148395336 17:47303772-47303794 CTGTTGTTTAAGGAGAACAAAGG - Intronic
1148541582 17:48484934-48484956 CAGTTGTTCAAGATGAAAAAAGG - Intergenic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1150039899 17:61849305-61849327 CAATTTTTCTAGAAGAAAACTGG + Intronic
1150543288 17:66125917-66125939 CTGATGGTTTAAAAGAAAAATGG - Intronic
1151017595 17:70575002-70575024 ATTTTATTCTAGAAGAAAATAGG + Intergenic
1153170019 18:2305175-2305197 CTGTCTTTCTGGAATAAAAAGGG + Intergenic
1153564648 18:6407374-6407396 CTATAGTTTTAGAAGAGAAAGGG + Intronic
1153808168 18:8728905-8728927 TTTTTGTTTTAGAAGAAACAAGG + Intronic
1155677087 18:28441851-28441873 CTTTAATTCAAGAAGAAAAATGG - Intergenic
1155751690 18:29431377-29431399 CTGTTGTTCTAATATATAAATGG - Intergenic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1157250484 18:46091775-46091797 CTGTTGATCTTGAAGAAACTGGG - Exonic
1158442230 18:57486651-57486673 CTTTTGTAATAGATGAAAAAAGG + Exonic
1158530040 18:58251745-58251767 CTGTTTTTCTAAAATAAGAAAGG - Intronic
1158594573 18:58804871-58804893 CTGTAGTTAGAGAAGAAGAAAGG - Intergenic
1159611520 18:70531046-70531068 CTGATGCTATAGAAAAAAAATGG - Intergenic
1159802876 18:72922741-72922763 CTGATTTTTTATAAGAAAAATGG + Intergenic
1163736627 19:18985444-18985466 CTGTGGTCTTAGGAGAAAAAAGG - Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1165361812 19:35341453-35341475 CAGTTCTTCTGGGAGAAAAATGG + Exonic
1165542146 19:36500537-36500559 CTTTATTTCAAGAAGAAAAATGG - Intergenic
1166062852 19:40337641-40337663 CTATTGTCTTAAAAGAAAAATGG - Intronic
925703296 2:6660254-6660276 CTGCTGTTGTAGTATAAAAAGGG - Intergenic
928796533 2:35028847-35028869 TTGTGGTTCTAGAACATAAAGGG - Intergenic
928868820 2:35950498-35950520 CTATTGTTCTAGAAGATCTAAGG + Intergenic
929238657 2:39630999-39631021 CAGTTTTTCCAGAAGAAAATTGG - Intergenic
929655560 2:43727862-43727884 CTATGTTTCTAGTAGAAAAATGG + Intronic
930853337 2:55985452-55985474 GTGATGATCTAGAAGGAAAAAGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931620249 2:64202996-64203018 CTATTTTCCCAGAAGAAAAATGG + Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
933365885 2:81353198-81353220 CTGTTGTTTTATATAAAAAAAGG - Intergenic
934175560 2:89576435-89576457 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934285876 2:91650799-91650821 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
936347255 2:111684556-111684578 CTTTTTTTCTACAAGAAAAATGG + Intergenic
936393938 2:112104127-112104149 TTATTCTTCTAGAAGAAAAAAGG + Intronic
936485429 2:112921385-112921407 CTGTTGTTACAGAACAAAGAAGG + Intergenic
936485652 2:112923336-112923358 CTGTTGTTACAGAACAAAGAAGG - Intergenic
937773922 2:125753366-125753388 CAGTAGTGCTAGAAGAAAAAGGG - Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938730167 2:134141289-134141311 GTATTGTTATAGCAGAAAAATGG + Intronic
939213507 2:139209490-139209512 CTATAGGTCTAGAAGAAAACAGG - Intergenic
939538632 2:143464220-143464242 CTATTTTTCTATAAGAAATAAGG + Intronic
939559581 2:143716832-143716854 CTGGTGTTCAATTAGAAAAAAGG - Intronic
939859373 2:147399036-147399058 CTGTTGTTTTCCAAGAAATATGG - Intergenic
939904384 2:147892673-147892695 TTGTTGTAGTAGAAGAAAACTGG + Intronic
940609778 2:155975398-155975420 CTGTTGTTTTAGAAGAAAAGAGG + Intergenic
941567562 2:167127961-167127983 GAGTTGATCTAGAAGAAAACTGG - Intronic
942740700 2:179174274-179174296 CTGTTTGACTAGAAGTAAAAAGG + Intronic
944031758 2:195242751-195242773 CTGTTGTACTTGCAGCAAAATGG - Intergenic
944301071 2:198125534-198125556 CTCTTGTACTTGAAAAAAAATGG - Intronic
947059670 2:226149250-226149272 GTGTTCTTCTAAAAGAGAAAAGG - Intergenic
947765454 2:232634417-232634439 CTTTTGTTTTAAAAGATAAAAGG - Intronic
1169545253 20:6643517-6643539 CTGTTGTGCTATAAGAACATGGG - Intergenic
1170070035 20:12357106-12357128 CTTTAATTCAAGAAGAAAAATGG + Intergenic
1171949029 20:31404583-31404605 GTGCTGGTCTAGAAGAAAACAGG + Intergenic
1173510798 20:43626799-43626821 GTGTTGATAGAGAAGAAAAAAGG + Intronic
1174103794 20:48147736-48147758 GTGTTGTTTTAGCATAAAAATGG - Intergenic
1174645726 20:52084024-52084046 CTGTTGTCTTACAATAAAAAAGG - Intronic
1178967738 21:37139196-37139218 CTGTTTTCCTAGAAAAACAAAGG + Intronic
1180285737 22:10742573-10742595 CTGACATTTTAGAAGAAAAATGG - Intergenic
1183830270 22:40415171-40415193 ATATTGTTCAAGAAGGAAAAGGG - Intronic
949121384 3:388758-388780 CTCTTCTTATAGAAGAAAAATGG + Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950100427 3:10353287-10353309 CTGTTGCTTTAGAAGAAAGTGGG + Intronic
951148124 3:19253866-19253888 ATTATGTTCTACAAGAAAAACGG + Exonic
951603164 3:24399350-24399372 CTGTTGGTTGAAAAGAAAAAAGG - Intronic
951777483 3:26325716-26325738 CTTTAGTTCAAGAAGGAAAATGG + Intergenic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
954013168 3:47661454-47661476 CTCTGGTTCAAGAATAAAAATGG + Exonic
957585052 3:82122405-82122427 CTCTAGCTATAGAAGAAAAAAGG - Intergenic
957812909 3:85251114-85251136 TTACTGTTCTAGTAGAAAAATGG - Intronic
958072713 3:88635390-88635412 CTGTTTTTTTAGAAGAAATAAGG - Intergenic
958113258 3:89178994-89179016 ATGTTTTTCTAAAAGCAAAATGG + Intronic
958757169 3:98263179-98263201 CTATTGCTCTAGAAGCCAAAAGG - Intergenic
958789730 3:98637529-98637551 CTGTAATCCCAGAAGAAAAAAGG + Intergenic
958885494 3:99721611-99721633 CAGTTGTAATAGAAGAAGAATGG + Intronic
960740999 3:120833592-120833614 CTATTGTTCTCAAAGAAAACTGG - Intergenic
961202924 3:125058594-125058616 CTGTTGATCTAGGATAAAACAGG + Intergenic
962317180 3:134366206-134366228 CTTTTGTTCTAGAGAAAAATTGG - Intronic
962840047 3:139225106-139225128 ATGTTCTTCAAGAAAAAAAAAGG - Intronic
963927367 3:150965259-150965281 CTGTTTCTCTTGAAGAAATATGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
965384688 3:168031870-168031892 CTGTTGGTTTAAAAGAAGAAAGG + Intronic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965502700 3:169475379-169475401 CAGTTTTTCCAGAAGCAAAATGG - Intronic
965935204 3:174100808-174100830 CTGGTGAACTAGAAAAAAAATGG - Intronic
967450874 3:189620860-189620882 CTCTGGTTCAAGAAAAAAAATGG - Intergenic
969258835 4:6021270-6021292 CTGTTGTTCCAGCAGAAACGGGG - Intergenic
970462731 4:16291811-16291833 CTGTTTTTCTAGGCCAAAAATGG - Intergenic
971179932 4:24320299-24320321 CATTTATTCTAGAATAAAAAAGG - Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971731588 4:30389607-30389629 CTTTTTTTATATAAGAAAAAGGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972172217 4:36360197-36360219 GTGTTGTTCTAGGTGAAATATGG - Intergenic
972221632 4:36962610-36962632 CTGTTGTCTAAGAAAAAAAATGG + Intergenic
972709088 4:41575932-41575954 TTGTTCTCCAAGAAGAAAAAAGG + Intronic
972716201 4:41648733-41648755 CTGTTGTACTGGAAAAACAACGG - Intronic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974155152 4:58062002-58062024 CTATTTTTCTGGAAGAAAATGGG - Intergenic
975064460 4:70043088-70043110 CTGTTGTTTTCGTAGATAAATGG - Intergenic
975617983 4:76266424-76266446 CTATTGTTCCAGAAAAAAACTGG - Intronic
975745537 4:77471319-77471341 CTTTAGTTCAAGAAGGAAAATGG + Intergenic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
977035026 4:91939745-91939767 CTGTTGTTTTATATAAAAAAAGG - Intergenic
978054131 4:104241956-104241978 TTATTGTTCTAGAAGAGTAAGGG + Intergenic
978891997 4:113840850-113840872 CTGTTGTTTTAGAATAAGGAGGG + Intergenic
979025098 4:115560859-115560881 TTGTTGTTCCATAAAAAAAAAGG + Intergenic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
980119687 4:128714868-128714890 CATTTGTTCTAGAAGAATAAAGG + Intergenic
980608487 4:135124526-135124548 CTGTCTTTCTACATGAAAAAAGG + Intergenic
980751084 4:137089672-137089694 CTGTTGCTTTAGGAGAATAAGGG - Intergenic
981053143 4:140331577-140331599 CTCATGTTCTAGAAGCCAAATGG - Intronic
981390782 4:144189232-144189254 CTGGTGGTCTAGAAGGAACAGGG - Intergenic
981768012 4:148274225-148274247 ATGGTGTTCAAAAAGAAAAATGG + Intronic
982266872 4:153545885-153545907 CTCCTGTTATAGAAGCAAAATGG + Intronic
983714231 4:170757184-170757206 CTTTAATTCAAGAAGAAAAATGG - Intergenic
983783802 4:171706668-171706690 CTATAGTTCTGTAAGAAAAATGG - Intergenic
983832090 4:172339887-172339909 CTTTAATTCAAGAAGAAAAATGG - Intronic
984070755 4:175109145-175109167 ATGTTGTCTGAGAAGAAAAAAGG + Intergenic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984994480 4:185415715-185415737 CTGTTGCTCCAGAAGAAACATGG - Exonic
985349709 4:189046090-189046112 CTGTTTTTCTATAAGTTAAAAGG + Intergenic
985930993 5:3057831-3057853 TTGTAGTTGTAAAAGAAAAAAGG - Intergenic
986427482 5:7649171-7649193 TTGTGGTTCTAGGAGATAAAGGG - Intronic
986429042 5:7663655-7663677 CTGGTCTTCCAGAAGAAACAAGG - Intronic
988054071 5:26069883-26069905 CTATTATTCTAGAAGAATAATGG - Intergenic
988080135 5:26403855-26403877 CTTTAGTTCTAGAAGCAAATAGG + Intergenic
988950173 5:36248263-36248285 CAGTGATTCTAGAAGAAATATGG - Intergenic
990310673 5:54534889-54534911 CTGTCATTCTAGAAAAAAATTGG + Intronic
990434990 5:55781109-55781131 CTGGTCTTCTAGAACCAAAAAGG - Exonic
990662797 5:58037122-58037144 GTGCTGCTCTAGAAGAAAATAGG + Intergenic
990806026 5:59663063-59663085 CTTTTGTTCTAGAAGTATTAAGG - Intronic
991008698 5:61858748-61858770 CAGTGGTTCAAGTAGAAAAATGG + Intergenic
991306799 5:65185359-65185381 CCCTTGTTCAAGAGGAAAAATGG - Intronic
993299579 5:86191185-86191207 CTTGTGTTCTAGTAGAAAAATGG - Intergenic
993838190 5:92841542-92841564 CTATTGTTTTGGAAGATAAAGGG - Intergenic
994164949 5:96598590-96598612 CCGTTTTTCTATGAGAAAAATGG + Intronic
994701246 5:103138277-103138299 TTGTTGTTCTATAACTAAAAAGG - Intronic
994757298 5:103810334-103810356 CTGTTATTCAAGTAGAAACATGG - Intergenic
995418764 5:111938766-111938788 CTGTTGATCAAGAACAATAATGG - Intronic
995422012 5:111978305-111978327 CTGTTGTTCTAGATTCCAAAGGG - Intronic
996201615 5:120682771-120682793 CAGTTATTCTAGAAGAAAATGGG - Intronic
996588090 5:125113987-125114009 CTGTCATTCAAGAACAAAAATGG - Intergenic
996602685 5:125284283-125284305 CTATTTTTCAGGAAGAAAAATGG + Intergenic
996876821 5:128249608-128249630 CTGTATTTTTAGAAGAAACAGGG + Intergenic
997036342 5:130196760-130196782 CTGTTGTAATAGAAGAATAATGG - Intergenic
997577031 5:134987182-134987204 CTGATCTTATAGAAGCAAAAAGG + Intronic
998078892 5:139258455-139258477 CTGTTCTTCTGGAAAGAAAATGG - Intronic
998360739 5:141584448-141584470 CTTTTTTTCTCTAAGAAAAATGG + Intronic
999845280 5:155472527-155472549 TTGCTGTTCAAGGAGAAAAAGGG + Intergenic
1000732399 5:164852406-164852428 GTGATTTTCGAGAAGAAAAATGG - Intergenic
1001829206 5:174771436-174771458 ATCTTCTTCAAGAAGAAAAAAGG + Intergenic
1001967217 5:175919267-175919289 CTGTTTTTATAGATCAAAAATGG + Intronic
1003391539 6:5717429-5717451 CTGTTGTTTTTGAAGAAACTGGG + Intronic
1003475651 6:6479807-6479829 CTGTAGTTCTAGAAGCCCAAAGG - Intergenic
1003819387 6:9878800-9878822 CTGTGGTGCTAGAAGCAATATGG - Intronic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1004200658 6:13544661-13544683 CTGTTTCTCTAGAATAATAATGG + Intergenic
1004587566 6:17016627-17016649 CTGAAGTTTTAGAAGTAAAATGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1007837126 6:44682370-44682392 CTGGTTTCCTAGAAAAAAAAGGG + Intergenic
1007955374 6:45913394-45913416 CTGTTACTCTAGAGAAAAAATGG + Intronic
1008057213 6:46957199-46957221 CTGTTTTTCTAGAAGTCAAAAGG + Intergenic
1008275456 6:49539145-49539167 CTTTCGTTCTAGGAAAAAAAAGG + Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008433755 6:51451108-51451130 CCACTGTTCTATAAGAAAAAGGG - Intergenic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1009161594 6:60289582-60289604 CTGTTTTTTTAGAATCAAAAAGG + Intergenic
1009385941 6:63084212-63084234 CTTTTGTTCTAGAAGGACTAAGG - Intergenic
1009912545 6:69949587-69949609 CTGTTATTTTACAAGAAAAATGG + Intronic
1010417634 6:75631672-75631694 CTGTTGTTGTAGCACAAAAGTGG - Intronic
1010504600 6:76641744-76641766 CAGATATACTAGAAGAAAAAAGG + Intergenic
1010706140 6:79113176-79113198 CTTATGTTCTGGAAGCAAAAAGG - Intergenic
1011226625 6:85115070-85115092 CTGTTGTTCTATAAAGAACAGGG + Intergenic
1012197092 6:96356731-96356753 CTGTTGTCCTCCAAGAAATACGG - Intergenic
1012659989 6:101875965-101875987 ATGTAATTCTAGAAGAAAACAGG - Intronic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013987599 6:116214450-116214472 ATGTTCTGCTAGGAGAAAAAAGG + Intronic
1014429660 6:121353111-121353133 CTATTTTTTTAGAACAAAAAAGG + Intergenic
1015156660 6:130103888-130103910 CTGATGTTCTAGAAAATACATGG - Intronic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1017528387 6:155263160-155263182 CTATAGTTCTAGAAAAAAATGGG - Intronic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1017670560 6:156765841-156765863 GGGTTTTTCTAGAAGAAAGAAGG + Intergenic
1018910606 6:168099154-168099176 TTGTTGTTTTAGAAGCAATAGGG - Intergenic
1020585487 7:10060448-10060470 TTGATTTTCTACAAGAAAAATGG + Intergenic
1020844673 7:13267884-13267906 ATGAAGTTGTAGAAGAAAAAAGG + Intergenic
1022602800 7:31777626-31777648 CTGTTGTTTAAGATGAAAATGGG - Intronic
1024435151 7:49343436-49343458 CTGGAGTTCTAGAACAAAAAGGG + Intergenic
1024644731 7:51361560-51361582 CTGCTTTTCTAGAAGAAATGAGG + Intergenic
1024973966 7:55096536-55096558 CTGTCTTCCTAGAAGTAAAATGG - Intronic
1025888696 7:65624302-65624324 GTCTTTCTCTAGAAGAAAAAAGG + Intergenic
1027764208 7:82319591-82319613 TTGTTGTGCTAGAAAAAAAGTGG + Intronic
1027969677 7:85062745-85062767 CTTTTAATCTAGAATAAAAATGG + Intronic
1028239200 7:88398852-88398874 CTGTTTTCCCAGAAGAATAAAGG - Intergenic
1031756082 7:125644552-125644574 CTGGTGTTTTAGTAGAAAAATGG + Intergenic
1031822051 7:126514446-126514468 CTGTTTTACTATCAGAAAAATGG + Intronic
1033851350 7:145499370-145499392 ATCTTGTTCTATAAGATAAAGGG - Intergenic
1034250405 7:149685991-149686013 GTGTTGTTCTATCATAAAAAGGG - Intergenic
1034604439 7:152298496-152298518 CTAAAGTTCTAGAAGAAAAAAGG + Intronic
1035699043 8:1624199-1624221 CTGTTGTATTGGAAGAAAATTGG + Intronic
1036565456 8:9934273-9934295 CTGTTGTTGTTGTAGAAATAGGG - Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036737846 8:11334186-11334208 CTGTTATAGTAGCAGAAAAATGG + Intergenic
1037135247 8:15452433-15452455 TTGTTATTCTGGAAGAAAAAAGG - Intronic
1037486360 8:19351108-19351130 CTGTTATTTTAGAAGCAAAAAGG + Intronic
1038428169 8:27478824-27478846 CTGTGGTTACAGAAGAAAACAGG + Exonic
1041539952 8:58972620-58972642 TTGTTGAACTAGAACAAAAATGG - Intronic
1041607416 8:59799159-59799181 TTATTGGTGTAGAAGAAAAAGGG + Intergenic
1042067943 8:64899548-64899570 TTATAGGTCTAGAAGAAAAAAGG - Intergenic
1042574544 8:70203381-70203403 CTGTTGTACTGGTAGAAGAAGGG - Intronic
1043002907 8:74781098-74781120 CAGTTTTTGTAGAAGAAGAAAGG + Intronic
1043316771 8:78932511-78932533 CTGTTACTCTGGTAGAAAAAGGG - Intergenic
1043413501 8:80024795-80024817 CTGTAGTTCCTGAAGAACAAGGG - Intronic
1043521653 8:81052824-81052846 CTGTTGTTCTTGGAAAACAAAGG + Intronic
1043640558 8:82444859-82444881 CTGTGGTGCTAGAATAAAAAAGG + Intergenic
1043650868 8:82589862-82589884 CTAGTGTTCTAGAAGATACATGG - Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1045193736 8:99908866-99908888 CTGTTGCTGAAGAAGAAATAGGG + Intergenic
1045550800 8:103170465-103170487 CTGTTGTTCTTGTAAGAAAAAGG + Intronic
1046401118 8:113704410-113704432 CTTTTGTTACAGAAGGAAAATGG + Intergenic
1047080642 8:121455973-121455995 CTGTTGTTCTAAAAATAAAGAGG + Intergenic
1047381379 8:124367116-124367138 CTTTTGTCCAATAAGAAAAAGGG - Intronic
1047691399 8:127358425-127358447 CTGTTAGGCTAGAAGTAAAATGG - Intergenic
1048013357 8:130476389-130476411 CTCTTGGTCTGGGAGAAAAAGGG + Intergenic
1050749311 9:8918458-8918480 CTGATGTTCTAAAAGTGAAAGGG - Intronic
1050823728 9:9916233-9916255 TTGTAGCTCTAGAAGTAAAAAGG + Intronic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1053268050 9:36730292-36730314 CTTTTGTTTGAGAAAAAAAAAGG - Intergenic
1053491777 9:38512175-38512197 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1053911597 9:42911133-42911155 GTAGAGTTCTAGAAGAAAAATGG + Intergenic
1053942038 9:43260807-43260829 CTGTTTTTATGAAAGAAAAAAGG - Intergenic
1055807124 9:80108325-80108347 TTGTTGTTCAAAAAAAAAAAGGG + Intergenic
1055870720 9:80876060-80876082 CTATTGTACTTGGAGAAAAAGGG - Intergenic
1056444707 9:86654536-86654558 CTGATGATCAAGAAAAAAAAAGG - Intergenic
1057480469 9:95441357-95441379 CTGTTGTGCCAAAAAAAAAATGG + Intergenic
1057672074 9:97101377-97101399 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1057715790 9:97494446-97494468 ATGTTATTTAAGAAGAAAAAAGG - Intronic
1059113844 9:111583064-111583086 CTGTTGTACTAGAAGGAAATGGG - Intronic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059397582 9:114047938-114047960 CTGCTGTTGTAGAAGAGAAGTGG + Exonic
1059938961 9:119339088-119339110 CTCTTGGTCTAGAAGAAAACAGG - Intronic
1060512402 9:124243432-124243454 CTATTGTTCTAGAAGCCTAAAGG - Intergenic
1061742786 9:132719354-132719376 CTGTAGTTTTTGAAGAAACAGGG - Intergenic
1203732090 Un_GL000216v2:99639-99661 CTGGCATTTTAGAAGAAAAATGG - Intergenic
1186639440 X:11439834-11439856 ATATTGTTCTAGAAGAAATGGGG - Intronic
1187638390 X:21259700-21259722 CTGCTGCTCCAGAAGAAAGATGG + Intergenic
1189529886 X:41869084-41869106 TTGATGATCTAGGAGAAAAAGGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1193343855 X:80383406-80383428 CTTCTTTTCTAGAAGAAAGAAGG - Intronic
1194487485 X:94503447-94503469 CTGTTATTGTAAAAGAAAGAAGG + Intergenic
1194567832 X:95515715-95515737 TTGTTGTTCAAGGAGAAAATTGG - Intergenic
1194824403 X:98543574-98543596 TTTTTTTTCCAGAAGAAAAAGGG + Intergenic
1194901421 X:99516191-99516213 ATGTTGTTCTTGAACAATAATGG - Intergenic
1195152605 X:102087486-102087508 ATGTGATTCTAGATGAAAAAAGG + Intergenic
1195596611 X:106698454-106698476 ATGTTTTTCTAGAAGTAAAAGGG + Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1195937022 X:110135228-110135250 CTTTTCTTCTAAAAAAAAAAAGG + Intronic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198701617 X:139402831-139402853 CTGCTATTGTAGAAAAAAAATGG + Intergenic
1199446898 X:147935185-147935207 CTGTTCTTCTATAACGAAAAGGG - Intronic
1200527045 Y:4286564-4286586 ATGTTGTTCTGGAATTAAAATGG + Intergenic
1201791647 Y:17847810-17847832 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1201809907 Y:18058179-18058201 ATGTTTTTCTAGCAGCAAAATGG + Intergenic
1202353256 Y:24017462-24017484 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1202517523 Y:25652653-25652675 ATGTTTTTCTAGCAGCAAAATGG + Intergenic