ID: 1063600063

View in Genome Browser
Species Human (GRCh38)
Location 10:7473086-7473108
Sequence CTGTTACCTTAGATGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063600063_1063600076 19 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600076 10:7473128-7473150 TGGGATATGGACATCTTTTGGGG No data
1063600063_1063600070 6 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600070 10:7473115-7473137 AGGTTCCAGGCCCTGGGATATGG No data
1063600063_1063600077 23 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600077 10:7473132-7473154 ATATGGACATCTTTTGGGGATGG No data
1063600063_1063600067 -7 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600067 10:7473102-7473124 GTAACAGATTCACAGGTTCCAGG 0: 2
1: 71
2: 291
3: 681
4: 1187
1063600063_1063600075 18 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600075 10:7473127-7473149 CTGGGATATGGACATCTTTTGGG No data
1063600063_1063600068 -1 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600068 10:7473108-7473130 GATTCACAGGTTCCAGGCCCTGG No data
1063600063_1063600074 17 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600074 10:7473126-7473148 CCTGGGATATGGACATCTTTTGG No data
1063600063_1063600069 0 Left 1063600063 10:7473086-7473108 CCCTTTGCCATCTAAGGTAACAG No data
Right 1063600069 10:7473109-7473131 ATTCACAGGTTCCAGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063600063 Original CRISPR CTGTTACCTTAGATGGCAAA GGG (reversed) Intergenic
No off target data available for this crispr