ID: 1063607002

View in Genome Browser
Species Human (GRCh38)
Location 10:7531402-7531424
Sequence ACTGAGAACCAGACGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063606993_1063607002 -9 Left 1063606993 10:7531388-7531410 CCTTCCCGACCCCCACTGAGAAC No data
Right 1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063607002 Original CRISPR ACTGAGAACCAGACGGTGGA TGG Intergenic
No off target data available for this crispr