ID: 1063609725

View in Genome Browser
Species Human (GRCh38)
Location 10:7552413-7552435
Sequence AATTGAAGAGTTGTGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063609720_1063609725 7 Left 1063609720 10:7552383-7552405 CCTAAACGTTAAAGTCCTGCAGA No data
Right 1063609725 10:7552413-7552435 AATTGAAGAGTTGTGGCCACAGG No data
1063609723_1063609725 -8 Left 1063609723 10:7552398-7552420 CCTGCAGAGGGAAGTAATTGAAG No data
Right 1063609725 10:7552413-7552435 AATTGAAGAGTTGTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063609725 Original CRISPR AATTGAAGAGTTGTGGCCAC AGG Intergenic
No off target data available for this crispr