ID: 1063611690

View in Genome Browser
Species Human (GRCh38)
Location 10:7568301-7568323
Sequence AAGGGCCTTCTCTGGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063611679_1063611690 21 Left 1063611679 10:7568257-7568279 CCCAGTAATCTTCCCAATAAAAC 0: 1
1: 0
2: 0
3: 20
4: 219
Right 1063611690 10:7568301-7568323 AAGGGCCTTCTCTGGGGCAAGGG No data
1063611682_1063611690 8 Left 1063611682 10:7568270-7568292 CCAATAAAACTTCTTAGACATTC 0: 1
1: 0
2: 0
3: 20
4: 264
Right 1063611690 10:7568301-7568323 AAGGGCCTTCTCTGGGGCAAGGG No data
1063611681_1063611690 9 Left 1063611681 10:7568269-7568291 CCCAATAAAACTTCTTAGACATT 0: 1
1: 0
2: 2
3: 41
4: 361
Right 1063611690 10:7568301-7568323 AAGGGCCTTCTCTGGGGCAAGGG No data
1063611680_1063611690 20 Left 1063611680 10:7568258-7568280 CCAGTAATCTTCCCAATAAAACT 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1063611690 10:7568301-7568323 AAGGGCCTTCTCTGGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063611690 Original CRISPR AAGGGCCTTCTCTGGGGCAA GGG Intronic
No off target data available for this crispr