ID: 1063611711

View in Genome Browser
Species Human (GRCh38)
Location 10:7568442-7568464
Sequence GGAACTGCTCCCAGAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063611704_1063611711 13 Left 1063611704 10:7568406-7568428 CCCACCACGGACATCTCGCTGAA 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1063611711 10:7568442-7568464 GGAACTGCTCCCAGAATAGGAGG No data
1063611706_1063611711 9 Left 1063611706 10:7568410-7568432 CCACGGACATCTCGCTGAAGACA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1063611711 10:7568442-7568464 GGAACTGCTCCCAGAATAGGAGG No data
1063611705_1063611711 12 Left 1063611705 10:7568407-7568429 CCACCACGGACATCTCGCTGAAG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1063611711 10:7568442-7568464 GGAACTGCTCCCAGAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063611711 Original CRISPR GGAACTGCTCCCAGAATAGG AGG Intronic
No off target data available for this crispr