ID: 1063612052

View in Genome Browser
Species Human (GRCh38)
Location 10:7570942-7570964
Sequence CCATGTGCACAGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 403}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063612052_1063612059 15 Left 1063612052 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG 0: 1
1: 0
2: 2
3: 36
4: 403
Right 1063612059 10:7570980-7571002 CGCTGTGCACGGTGTAGGCAGGG No data
1063612052_1063612061 21 Left 1063612052 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG 0: 1
1: 0
2: 2
3: 36
4: 403
Right 1063612061 10:7570986-7571008 GCACGGTGTAGGCAGGGGCCAGG No data
1063612052_1063612056 4 Left 1063612052 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG 0: 1
1: 0
2: 2
3: 36
4: 403
Right 1063612056 10:7570969-7570991 GTCTGCATGCACGCTGTGCACGG No data
1063612052_1063612060 16 Left 1063612052 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG 0: 1
1: 0
2: 2
3: 36
4: 403
Right 1063612060 10:7570981-7571003 GCTGTGCACGGTGTAGGCAGGGG No data
1063612052_1063612058 14 Left 1063612052 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG 0: 1
1: 0
2: 2
3: 36
4: 403
Right 1063612058 10:7570979-7571001 ACGCTGTGCACGGTGTAGGCAGG No data
1063612052_1063612057 10 Left 1063612052 10:7570942-7570964 CCCTCTGCCTTCTGTGCACATGG 0: 1
1: 0
2: 2
3: 36
4: 403
Right 1063612057 10:7570975-7570997 ATGCACGCTGTGCACGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063612052 Original CRISPR CCATGTGCACAGAAGGCAGA GGG (reversed) Intronic
900630290 1:3631518-3631540 CCATCTGCACGGGAGGCAGCAGG - Exonic
900662144 1:3790140-3790162 CCATGGGCCCGGAAGGCAGCCGG - Intronic
900851547 1:5146928-5146950 CCATGTGCCCATAAGGCAGGTGG - Intergenic
900966274 1:5960909-5960931 CCATGTTCACAGCAGCCAGAAGG + Intronic
901034152 1:6326223-6326245 CCATGTGTGCAGTAGGGAGAGGG + Intronic
902230521 1:15024549-15024571 CCAAGTGCAAAGAACTCAGATGG + Intronic
902330999 1:15731234-15731256 CCATGTTCACCGAGAGCAGAGGG - Exonic
902455638 1:16532159-16532181 CCATGAGGACAGACAGCAGAAGG - Intergenic
902496535 1:16875756-16875778 CCATGAGGACAGACAGCAGAAGG + Intronic
902691518 1:18112755-18112777 TCATCTGCACAGATGGGAGAGGG + Intronic
903040000 1:20522516-20522538 CCAGGAGCACAGAATGGAGAAGG + Intergenic
903291329 1:22316036-22316058 CCCTGGGCACAGGAGTCAGAGGG + Intergenic
904283198 1:29435783-29435805 GCATGTGCAAAGAAGTCACATGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904957703 1:34299137-34299159 CCATGTACACAAAAGGGAAATGG - Intergenic
905300937 1:36985821-36985843 TGATGTGCACAGCAGGGAGACGG - Intronic
905697441 1:39985668-39985690 CCATCTGCATGCAAGGCAGAGGG - Intergenic
907147022 1:52244120-52244142 CAATGTTTACAGAAGCCAGATGG + Intronic
907291888 1:53419878-53419900 CCATAGGCACAGAAGGTACAGGG - Intergenic
908714683 1:67056433-67056455 CCATGTCCTCACATGGCAGAAGG + Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
915316888 1:155033741-155033763 CCAGGAGCACAGAAGTCAGCGGG - Exonic
915701840 1:157803918-157803940 CCATGTGGAAAGAAGACACAGGG - Exonic
915837256 1:159187834-159187856 CCATGTGCACAGAAGGTAGTAGG + Intronic
916470294 1:165117195-165117217 CGATTTGCAGAGAAGGCAGGAGG + Intergenic
916830149 1:168482483-168482505 ATATGTGCACAGAAGGCTGTGGG + Intergenic
916970813 1:170013067-170013089 CCATGTCCTCACATGGCAGAAGG - Intronic
917150733 1:171941916-171941938 CCTTGTGCAAAAAAGGCATATGG - Intronic
917682049 1:177377327-177377349 CTCTGTGCTCAGAAGCCAGAGGG - Intergenic
918200993 1:182266754-182266776 CCATCTGCACAGCAGGAAGCAGG + Intergenic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
920101029 1:203517117-203517139 CCATGTGCACATAAGACAGCAGG + Intergenic
920204110 1:204279100-204279122 TCATCTGCACAGAAGGAGGAGGG + Intronic
920757991 1:208753534-208753556 CTATATGCACAGTAGGCTGAAGG + Intergenic
920805177 1:209226768-209226790 CCATGAGCACAGAATTCCGATGG - Intergenic
920987282 1:210902436-210902458 CCATGTGCACAGAGGTGTGAGGG - Intronic
924750733 1:246886646-246886668 CCATGGACACAGAGGGCCGATGG + Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1065198496 10:23290118-23290140 CCATCTGAACAGCAGGAAGAAGG - Intronic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1065891812 10:30127677-30127699 CCATTTGGAGAGATGGCAGAGGG + Intergenic
1066334833 10:34465228-34465250 CCATGGACACAGAAGCCTGATGG + Intronic
1067058902 10:43067752-43067774 AAATGTGCACAGAAGTCAGCAGG + Intergenic
1067314952 10:45152266-45152288 GCTTGAGCACAGGAGGCAGAGGG - Intergenic
1067558071 10:47286025-47286047 CCGTGTGCAGAGCAGGCAGAGGG + Intergenic
1068577888 10:58705272-58705294 CCATGTGTTCTGAAGGCAAAGGG + Intronic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069464449 10:68625967-68625989 CCATCTACTCAGAAGGCTGAGGG + Intronic
1069468591 10:68664887-68664909 CCAGTTGCTCAGAAGGCTGAGGG - Intronic
1069517529 10:69090526-69090548 CCATGTGCAGACAAGGGAGAAGG - Intronic
1070659752 10:78296072-78296094 CCCTTTGCACAGAAGCCAGGGGG + Intergenic
1071462825 10:85914573-85914595 CCATGTCCACAGAGGGCAGCTGG - Intronic
1073893970 10:108132599-108132621 CCATGTGCACAGTAAGGAGCAGG - Intergenic
1075566372 10:123507484-123507506 CCATGTTTACATAAGACAGATGG - Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1075984714 10:126774741-126774763 GAATGTCCACAGCAGGCAGAGGG - Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076685011 10:132194602-132194624 CTCTGAGCACAGAAGGGAGAGGG - Intronic
1078009693 11:7563238-7563260 TCATGTGTACAGAATGGAGAGGG + Intronic
1078030483 11:7746181-7746203 CAATGTCCACAGAAGCCAAATGG - Intergenic
1078596656 11:12692944-12692966 CCAGTTGCACAGAAGGAAAAGGG - Intronic
1079504642 11:21139813-21139835 CCATGTGCACATAAGTCTGGAGG + Intronic
1079999276 11:27328997-27329019 CCTTATGCGCAGAAGTCAGAGGG - Intergenic
1081105023 11:39056201-39056223 CCATATGCACAGAATTCTGATGG + Intergenic
1081564811 11:44252057-44252079 CCATGAGCACACCAGGCAGAGGG + Intergenic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1083603190 11:63961523-63961545 CTAGGGGCTCAGAAGGCAGAGGG + Intergenic
1084010608 11:66346471-66346493 CCAGGTGCTCATAAGGGAGAGGG - Exonic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1086135359 11:83438819-83438841 CCAAGGCTACAGAAGGCAGAGGG - Intergenic
1087142064 11:94774363-94774385 CCTTGAGCACAGGAGGCAGGAGG + Intronic
1087819647 11:102697614-102697636 CCAGCTGCACAGGAGGCTGAGGG - Intronic
1088091875 11:106050597-106050619 CCATTTTCCCATAAGGCAGATGG + Intergenic
1088357837 11:108961709-108961731 CCGTGGGCACACAGGGCAGAAGG + Intergenic
1088975571 11:114813343-114813365 CCATGTCCACAGAAGGCCTGAGG + Intergenic
1089281019 11:117374553-117374575 CCATGGGCTTAGAAGGCAGATGG + Intronic
1090011752 11:123051375-123051397 CCATGTGCACAGAAAACATGAGG + Intergenic
1091239523 11:134043184-134043206 ACAGATGCTCAGAAGGCAGAAGG - Intergenic
1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG + Intronic
1091536429 12:1414299-1414321 CCATCTGCAAAGTAGGAAGAGGG - Intronic
1091722151 12:2821241-2821263 CCCTGTGCACAGCAGGTGGACGG - Exonic
1092494002 12:8973442-8973464 TCATATGGGCAGAAGGCAGAAGG - Intronic
1092909163 12:13130873-13130895 CCAAGAGCACAGCAGTCAGAGGG + Intronic
1094047248 12:26180567-26180589 CTATGTGCTCAGAAAGCACAGGG - Intronic
1094822040 12:34233607-34233629 TCAGGAGCAGAGAAGGCAGATGG + Intergenic
1095416226 12:41979707-41979729 CCATGGCAACAGAAAGCAGACGG + Intergenic
1096186820 12:49586987-49587009 CCAGGGTCACAGGAGGCAGATGG + Intronic
1096328412 12:50687175-50687197 CCAAGTGCACAGCAGGCACCAGG + Intronic
1096578736 12:52570888-52570910 CCATGGGCCCAGAAGACTGATGG - Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096799948 12:54103823-54103845 CCCTGTGGATAGAAGTCAGATGG + Intergenic
1097189914 12:57214687-57214709 CCAGATGCACCGATGGCAGAGGG - Intergenic
1097246374 12:57609912-57609934 CCAGGTCCTCAGGAGGCAGAGGG - Intergenic
1097373847 12:58817374-58817396 CCATGTGCTCACACGGTAGAAGG - Intergenic
1097861147 12:64519948-64519970 TCACGTACACAGAAGGCAGGGGG - Intergenic
1098038922 12:66334823-66334845 CCCTCTCCACAGAAGCCAGAGGG - Intronic
1099798698 12:87430161-87430183 CCATGTTCAAATAAGGCAAATGG + Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1101410711 12:104465707-104465729 CCATGTGCGCAGAACTCAGAAGG + Intronic
1101414819 12:104499816-104499838 CCATGGCCACAGGGGGCAGAAGG - Intronic
1102097053 12:110249284-110249306 CCATGTGGAAAGAAGCCAAACGG + Intergenic
1102231284 12:111264144-111264166 CCATTAGCACAGAAGACTGAGGG + Intronic
1102262029 12:111448734-111448756 CCATGTGGACTGACGGTAGATGG - Exonic
1103351614 12:120287568-120287590 CCAGGTGGAGAGAAGGGAGAAGG - Intergenic
1104357879 12:128104326-128104348 CCAAGTGCACTGCAGTCAGATGG - Intergenic
1104522465 12:129488039-129488061 CCATGTCCTCACAAGGCATACGG - Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1106392669 13:29350767-29350789 CCATCTGCAAACAAGGAAGAGGG - Intronic
1106629890 13:31460316-31460338 TTAAGTGCACAGGAGGCAGAGGG + Intergenic
1108284666 13:48894863-48894885 CCATTTCCACAGCAGTCAGATGG + Intergenic
1108793616 13:54003399-54003421 GCATGTGCACAGTAAGTAGATGG + Intergenic
1109442420 13:62393315-62393337 TACTGTGCACAGAAGGCTGAAGG + Intergenic
1109742150 13:66568221-66568243 CCATGTGCAAATCAGGAAGAGGG + Intronic
1109946682 13:69443438-69443460 CCATGTGCAAAGAAGGATGTTGG - Intergenic
1110569327 13:76987959-76987981 CCAAATGCAAAGAAGGGAGATGG - Intergenic
1110750792 13:79113284-79113306 CCATGTGAAGACAAGGGAGAAGG - Intergenic
1113180311 13:107617692-107617714 ACAAGTGCAAAGAAGGCAGCTGG + Intronic
1115051450 14:29068638-29068660 AAATGTGCACAGAATGTAGAAGG - Intergenic
1115964910 14:38877203-38877225 CCAGCTACTCAGAAGGCAGAAGG + Intergenic
1116070918 14:40044528-40044550 TTTTGTGAACAGAAGGCAGATGG - Intergenic
1116236679 14:42287145-42287167 CCTTGTTAAAAGAAGGCAGAAGG - Intergenic
1117638232 14:57769968-57769990 CCCTTGGCAAAGAAGGCAGATGG - Intronic
1118725113 14:68623484-68623506 CAACATGCATAGAAGGCAGATGG + Intronic
1119179057 14:72592239-72592261 CCATTTGGACAACAGGCAGAGGG + Intergenic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119480026 14:74953315-74953337 ACATATGTACAGAAGGCAGGAGG - Intronic
1119607642 14:76034545-76034567 CCCTGTGCAAAGAAGGTAGGAGG + Intronic
1121668527 14:95690964-95690986 CCAGGGGCACAGAAGAGAGAGGG - Intronic
1121873391 14:97429815-97429837 CTATGTCCTCAGATGGCAGAAGG + Intergenic
1122033498 14:98931074-98931096 CTGTGTGCACAGAAGACAGGTGG - Intergenic
1122165174 14:99817835-99817857 CCATGATCACAGTAAGCAGAAGG + Intronic
1122578303 14:102755597-102755619 CCATGTGCTCAGGACACAGAGGG - Intergenic
1122610847 14:102982401-102982423 TCATGTGCACAGGAGACAGCGGG + Intronic
1122978051 14:105179053-105179075 GCATGGGCACAGCAGGCACATGG - Intronic
1123990365 15:25678943-25678965 CAATGAGCAGAGATGGCAGAGGG - Exonic
1124040340 15:26096205-26096227 CCATGTTCAAATAAGGCAAACGG - Intergenic
1124422116 15:29531514-29531536 CCATGGGGACGGAAGGCAAAAGG + Intronic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1125725830 15:41867696-41867718 CCATGGGCACAGACTGCAGCTGG - Intronic
1126806506 15:52354737-52354759 CCATCTACTCAGGAGGCAGAGGG + Intronic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128912053 15:71524531-71524553 CCATGAGCACAGGAGGAAGATGG + Intronic
1129629111 15:77237459-77237481 CCATGTTCACAGACCACAGAAGG - Intronic
1130759670 15:86805522-86805544 ACATGTGCACAATAGGAAGAGGG + Intronic
1130938797 15:88491080-88491102 CAAGGTGCAGAGAAGGCAGGTGG - Intergenic
1131116303 15:89798140-89798162 AAATGTGTACAGAAGGCAGGAGG - Intronic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1132977759 16:2719206-2719228 CCATGTGCACAGGAGGTGGAAGG - Intronic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1134090114 16:11387047-11387069 CCCTGTGCCCAGGAGGCAGGGGG + Intronic
1134528804 16:14965971-14965993 CTGTGTGCCCAGAAGGCAAATGG - Intergenic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1135393907 16:22116569-22116591 CCATCTGCAGAGGAGGCAGAGGG + Intronic
1137008025 16:35296624-35296646 CCATGTGCACAGGGGGCATTGGG + Intergenic
1139867560 16:70075006-70075028 CTGTGTGCCCAGAAGGCAAATGG + Intergenic
1141159420 16:81619172-81619194 CCAAGTGCAAAGCAGGCAGGAGG - Intronic
1141762486 16:86038042-86038064 ACATTTGCAGAGAAGGAAGAGGG + Intergenic
1142236540 16:88925149-88925171 CCATGTCCGCAGTGGGCAGAGGG + Intronic
1142591969 17:1010217-1010239 CCAGGAGCAGAGAAGGCTGAAGG + Intronic
1142660053 17:1422529-1422551 CAAGTTGCACAGAATGCAGAGGG + Exonic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142814824 17:2417002-2417024 CCAAATGCACAGAAGGCACTCGG + Exonic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143467488 17:7147379-7147401 CGATGTGCACATAAAGCACATGG - Intergenic
1144574097 17:16418079-16418101 ACATGACCTCAGAAGGCAGAAGG - Intronic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1144850182 17:18240291-18240313 GCATCTGCACAGAATGCTGATGG - Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1148611680 17:48968835-48968857 CCCTGTGCCCAGAAGGGAGGAGG - Intergenic
1149651462 17:58278925-58278947 ACCTGGGCACAGAAGGGAGATGG + Intronic
1149990265 17:61379304-61379326 CCATGTTTCGAGAAGGCAGAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150333573 17:64313882-64313904 CAAGGTCCACAGAAGGCAGGTGG + Intergenic
1151289659 17:73140459-73140481 CCAAGCGCAGAGAAGGCACACGG + Intergenic
1151349864 17:73525316-73525338 CCAGGGGCACAGCAGGCAGGAGG + Intronic
1151567151 17:74905038-74905060 ACATGGGGACAGAAGGCAGCGGG + Intergenic
1152121012 17:78418360-78418382 CGCTGTACACAGAAGGCAGGCGG - Intronic
1152212848 17:79012105-79012127 CCATGGGCACAGCAGCCACAAGG - Intergenic
1152375655 17:79917578-79917600 CCTTGTGCACAAGAGGCAAATGG - Intergenic
1152436345 17:80278588-80278610 CCATGGGCCCTGGAGGCAGACGG + Intronic
1152622448 17:81372160-81372182 CCATGGGCCCAGAAGGCACAGGG + Intergenic
1152910331 17:83001577-83001599 CTATGGTCACAGAAAGCAGAGGG + Intronic
1153349142 18:4059281-4059303 CCATGTGCAAAGAAAGAAAAGGG - Intronic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1154014617 18:10605232-10605254 CCCTGTGCTCACAAGGCAGAGGG - Intergenic
1154516870 18:15179744-15179766 CCATCTGCAGAGAAGAAAGATGG - Intergenic
1155328454 18:24690239-24690261 TCATGTGCACAGAAAGAATATGG - Intergenic
1156636335 18:39034680-39034702 GCATGTGCATAGAAGAGAGAAGG - Intergenic
1156828137 18:41457921-41457943 GCAGGTGCACGGAAGCCAGAGGG + Intergenic
1157150127 18:45208520-45208542 ACATGTGGAAAGAAGGGAGAAGG + Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1158604713 18:58885470-58885492 TTATGTGCACAAAAGGCAGGAGG - Intronic
1159790317 18:72771170-72771192 TTATGTGAACAAAAGGCAGATGG + Intronic
1160483208 18:79261907-79261929 CCAAGTGTTCAGCAGGCAGAAGG - Intronic
1162753956 19:12846085-12846107 CCAGCTACACAGAAGGCAGAGGG + Intronic
1162772555 19:12958033-12958055 CTGTGTGCACAGAAGACACATGG - Intergenic
1163512264 19:17742400-17742422 CCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1164257822 19:23544636-23544658 CCATGTCCACAGAATAGAGAGGG - Intronic
1164559039 19:29275979-29276001 CCATGTGCAGAGTAGGCAGAAGG - Intergenic
1165158795 19:33803896-33803918 CCTTGTGCACACAGGGCAGGTGG + Intronic
1166527469 19:43521426-43521448 TCATGTGCACAAAAGACAGCAGG - Intronic
1166654259 19:44598829-44598851 CCATCTCTACAGAAGGAAGAAGG - Intergenic
1166713322 19:44951069-44951091 CAAAAAGCACAGAAGGCAGAAGG + Intronic
1168693907 19:58394498-58394520 GCCTGTGCACAGCAGCCAGATGG - Exonic
1202706525 1_KI270713v1_random:28508-28530 CCATGAGGACAGACAGCAGAAGG - Intergenic
925745084 2:7037085-7037107 ACTTGATCACAGAAGGCAGAGGG - Intronic
926228755 2:10986925-10986947 CCATGTAGGAAGAAGGCAGAGGG + Intergenic
926702793 2:15815023-15815045 ACATTTGCACAGAAGGAAAATGG - Intergenic
926971299 2:18470260-18470282 CCATCTGCAAACAAGGAAGAGGG - Intergenic
929896252 2:45963225-45963247 ACATGTTCCCAGAAAGCAGAGGG - Intronic
930977743 2:57484592-57484614 CCATATCCATGGAAGGCAGAAGG + Intergenic
931221508 2:60292360-60292382 CCATTGGCACATAAGTCAGAAGG - Intergenic
931765864 2:65455972-65455994 CCATGTAGACAGACCGCAGAGGG - Intergenic
932857778 2:75255614-75255636 CCATGTCCTCACATGGCAGAAGG - Intergenic
933347396 2:81106453-81106475 CCATGTTCCCAGAAGACTGAGGG - Intergenic
934891438 2:98073884-98073906 TCATGTTCTCAGATGGCAGAAGG + Intergenic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
935640506 2:105285543-105285565 CCAGGTACACAGCAGGCAGCTGG + Intronic
935720519 2:105975089-105975111 CCTGGAGCAGAGAAGGCAGAGGG - Intergenic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936053782 2:109245174-109245196 CCAGGAGCACAGAAGCCACATGG - Intronic
936081692 2:109436872-109436894 CCCTGTGGAGAGAAAGCAGAAGG - Exonic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
936600827 2:113892545-113892567 CCATGTGCAAATAAAGCTGAAGG - Intronic
937594501 2:123657633-123657655 CCATGTGCTCACATGGCAGTAGG + Intergenic
937899802 2:127011247-127011269 CCTAGTGCAGAGAAGGCAGGGGG - Intergenic
938105437 2:128526799-128526821 ACATGTGCACAGGAGGCAGTGGG + Intergenic
938408882 2:131047622-131047644 CCCTGGCCACAGAAGCCAGAAGG + Intergenic
938894729 2:135738647-135738669 TCTTGTGTACAGAAGCCAGATGG - Intergenic
939906753 2:147925740-147925762 CCATCTGCACAGAGGACATAAGG - Intronic
940121086 2:150266850-150266872 CTATGTCCTCAGATGGCAGAAGG + Intergenic
941079738 2:161046557-161046579 CCATGAGCAAAGAAGGCAAGTGG + Intergenic
942734850 2:179097612-179097634 CCCAGGGCACAGAAGGCACAAGG + Intergenic
944223578 2:197326648-197326670 CCATGTCCTCACATGGCAGAAGG - Intergenic
944366754 2:198929866-198929888 CCATGTGCATAGAAACCAGAGGG - Intergenic
944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG + Intronic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
945259553 2:207831155-207831177 GCAGCTGCACAGAAGGCAGCAGG - Intronic
947413879 2:229872447-229872469 CCAGCTGCTCAGAAGGCTGAAGG + Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1169651139 20:7868783-7868805 GCATTTCCAGAGAAGGCAGAGGG - Intergenic
1169709116 20:8541427-8541449 CCATGTGCCCAGAAGGAGAATGG - Intronic
1169912622 20:10659663-10659685 TCCTCTGCCCAGAAGGCAGATGG + Intronic
1172266048 20:33615205-33615227 CCATGGACACAGAATGCAGATGG - Intronic
1172602712 20:36194996-36195018 CCCTGTGCTCACAAGGTAGACGG - Intronic
1173364807 20:42375479-42375501 CCATGTCCTCATATGGCAGAAGG - Intronic
1174164732 20:48576683-48576705 CCAGGTCCACAGCAGGGAGAGGG - Intergenic
1175185784 20:57178925-57178947 TCATGAGCACAGAAGGGACAAGG + Intronic
1175772006 20:61629875-61629897 CCAGCTGAACAGGAGGCAGAGGG + Intronic
1175869851 20:62203703-62203725 CCCTGGGGACAGAAGGTAGACGG - Intergenic
1177151414 21:17458971-17458993 CCATGTACTCAGGAGGCTGAGGG + Intergenic
1177326155 21:19591827-19591849 CCACCTGCTCAGGAGGCAGAGGG - Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1179278798 21:39916158-39916180 CCATGTGCTCAGAGAGAAGAAGG + Intronic
1179832550 21:44006459-44006481 CCCTCTGCACAGAGGGCAAAAGG - Intergenic
1180255054 21:46621224-46621246 CCATCTGCAGAGTAGACAGAGGG - Intergenic
1180631584 22:17233778-17233800 CCATCTACACAGACTGCAGAAGG + Intergenic
1180723509 22:17927356-17927378 CATTGTGCACAGTAGTCAGAAGG - Intronic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181271520 22:21661403-21661425 CCCAGTGCACTGCAGGCAGAGGG - Intronic
1181861471 22:25822572-25822594 ACATGTACACAGTAAGCAGATGG + Intronic
1182130634 22:27847854-27847876 CAATATGCACAGAAAGCTGAAGG - Intergenic
1182242976 22:28931928-28931950 CTATGGACAGAGAAGGCAGATGG + Intronic
1184071887 22:42151853-42151875 CAATGTGGACAGGAGGCACAGGG + Intergenic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1184212519 22:43044188-43044210 CTAGGTACAGAGAAGGCAGAGGG - Intronic
1184963080 22:47945626-47945648 ACCTTTGCACAGAAAGCAGAAGG - Intergenic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949335290 3:2968035-2968057 CCATCTGAACAGAAGCCTGAAGG - Intronic
949351708 3:3129932-3129954 CCATGAGAACTGAAGGAAGAAGG + Intronic
950175426 3:10870123-10870145 CCATGTTCACAGACAGGAGAAGG + Intronic
953355657 3:42254414-42254436 CCATGTGGCCAGCAGCCAGAGGG - Intergenic
953390132 3:42529048-42529070 ACATGTGCACAGGAGGCAGCAGG - Intronic
954733936 3:52689223-52689245 CCATGTACACAGAAGACAAAGGG - Intronic
955411659 3:58659381-58659403 CCCTGTGTACAGAAGGCCGCAGG - Intronic
955735284 3:62032202-62032224 CCATGTTCACAGGAGCCAGTGGG + Intronic
956994918 3:74814999-74815021 GCATGTGCACAGAAGCATGATGG - Intergenic
958671519 3:97211523-97211545 CCATCTGCAAATAAGGAAGAGGG - Intronic
959309613 3:104717316-104717338 CCATGTGGAGAGTAGGCTGAAGG - Intergenic
959579347 3:107968131-107968153 CCATGTCCACAGGAGACAGCAGG - Intergenic
960265810 3:115619659-115619681 CCATGTGCAGAGGCAGCAGAGGG + Intergenic
960936486 3:122907146-122907168 CCATGAAGACAGAAAGCAGATGG - Intergenic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
964735561 3:159913688-159913710 ACATCTGCTCAGAAGGCAGCTGG + Intergenic
966454194 3:180096006-180096028 TCATATGCACAGAAAGCATAGGG - Intergenic
967808371 3:193734771-193734793 CCGTGTGCACACAAACCAGATGG - Intergenic
967979402 3:195056610-195056632 CCATTTGCACAGCAGGAAGCAGG + Intergenic
968027137 3:195451853-195451875 CCAGGTCCACAAAAGGGAGAAGG - Intergenic
968427169 4:531812-531834 CCATGTCCACGCAAGGCACAAGG + Intronic
968618150 4:1591627-1591649 CCATGTGCTCAGAAGGAACCAGG - Intergenic
968848370 4:3060766-3060788 CCATGTGCACAGTAAGGAGCAGG + Intergenic
969212535 4:5698898-5698920 CCATGTGAACAGTAGCCACATGG - Intronic
969271045 4:6102463-6102485 CCATGTCCTCACATGGCAGAAGG - Intronic
969576453 4:8038816-8038838 CCAATTTCCCAGAAGGCAGAGGG - Intronic
971257464 4:25028508-25028530 GCAGCTGCAGAGAAGGCAGATGG + Exonic
971969200 4:33599989-33600011 CCATGTGCACAGTAAGGAGCAGG + Intergenic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
976806470 4:89052636-89052658 CCATGTCAACAGAAGCCAGGAGG - Intronic
980480550 4:133381528-133381550 CCAGGAGCACTGAAGTCAGAAGG - Intergenic
980706659 4:136505336-136505358 GAAAGTGCACAGAAGGCAGATGG + Intergenic
982812590 4:159844715-159844737 CCATGTGCTGGGAATGCAGAGGG - Intergenic
983921433 4:173349818-173349840 CCAGGTGTTCAGAAGGCAGTGGG + Intergenic
985066919 4:186131389-186131411 CCATGTACACACAAAGAAGAAGG + Intronic
985345570 4:189001411-189001433 CCATGTGCACAGTAAGGAGCAGG + Intergenic
985840940 5:2305304-2305326 CCATGGTCAGAGAAGGCAGAGGG + Intergenic
985912047 5:2892420-2892442 GAATGGGCACAGAAGGCAGCTGG - Intergenic
986268542 5:6211402-6211424 CCATGTGCACAGTAAGGAGCAGG - Intergenic
986456760 5:7927633-7927655 AGGTGTGCACAGAAGGCAGGTGG + Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
987190091 5:15468654-15468676 CCAGATGCACAAAAGGAAGAGGG + Intergenic
987246348 5:16053095-16053117 CCTTTTACTCAGAAGGCAGAAGG + Intergenic
987849586 5:23333392-23333414 TCATGTGCACACAAGGCAAGGGG - Intergenic
988365933 5:30299049-30299071 CCATGTGCACTCAAGGCACTTGG + Intergenic
988441769 5:31241832-31241854 CCATGTGCCTAGAAGGAAAAAGG + Intronic
993396467 5:87395784-87395806 ACTTGAGCCCAGAAGGCAGAGGG + Intronic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
994931669 5:106195646-106195668 CCATGTTCATAGAAAACAGAAGG - Intergenic
995679463 5:114700759-114700781 AAATGTGCACAGAAAGGAGATGG + Intergenic
997801518 5:136867365-136867387 CCATGTGCGGAGGAGGCTGATGG + Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
997868585 5:137486966-137486988 CCACGTCCACAGAAGTCACAGGG + Intronic
1000151641 5:158507882-158507904 CCATGTTCTCACATGGCAGAAGG + Intergenic
1000269047 5:159665683-159665705 CCCTGTGCCCATTAGGCAGATGG - Intergenic
1001218706 5:169880309-169880331 CCATATGCCTGGAAGGCAGAAGG - Intronic
1001231107 5:169989522-169989544 CTATGGTCCCAGAAGGCAGAGGG + Intronic
1001541264 5:172541389-172541411 TCATGTACACAGGAGGCAGAGGG - Intergenic
1001697114 5:173679123-173679145 CCATCCACACAGCAGGCAGAAGG - Intergenic
1002571473 5:180142035-180142057 CCACGTGCACAAAACACAGATGG - Intronic
1005674668 6:28141643-28141665 GCATGGGCACACAAGGCGGAGGG + Intergenic
1005817277 6:29564398-29564420 CCAGCTGCTCAGAAGGCTGAGGG - Intronic
1006009675 6:31032009-31032031 CCATGTCCCCAGAATGCAGGTGG - Intronic
1007964089 6:45987667-45987689 CCATCTGCACACCAGGAAGAAGG - Intronic
1009763122 6:68034770-68034792 CCATGTCCTCACATGGCAGAAGG - Intergenic
1009964418 6:70563651-70563673 CCATGTGCACAGACGTCATCCGG - Intergenic
1010825858 6:80473863-80473885 CCAGCTGCTCAGAAGGCTGAAGG + Intergenic
1011152010 6:84284794-84284816 ATATAAGCACAGAAGGCAGAAGG + Intergenic
1011517355 6:88167344-88167366 CCGTGCACACAGGAGGCAGACGG - Intergenic
1013789851 6:113824521-113824543 CCATGGGCTCAGCAGGGAGAAGG - Intergenic
1013991461 6:116258645-116258667 ACCTGTGCACAGCAGCCAGATGG + Intronic
1014940034 6:127427585-127427607 GCTTGAGCTCAGAAGGCAGAGGG - Intergenic
1015085325 6:129283776-129283798 CCATGAGCATAGTAAGCAGAGGG - Intronic
1015330189 6:131968836-131968858 CCATGTGCTCTGGAGGAAGAAGG + Intergenic
1015661651 6:135581926-135581948 CCATGCCTACAGAAGGCTGAAGG - Intergenic
1016014965 6:139174364-139174386 CCCTGTGCACAGAAGACACAAGG - Exonic
1016301303 6:142634907-142634929 CCATCTGCACACCAGGAAGAAGG - Intergenic
1016319158 6:142823128-142823150 CCATCTGCAGAGGCGGCAGAGGG - Intronic
1016515061 6:144884091-144884113 CCATGTGCAGAGATGGCCCAAGG + Intergenic
1016850590 6:148614764-148614786 CCATGTTCAAATAAGGCAAACGG + Intergenic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019194677 6:170274160-170274182 GCTGGTGCTCAGAAGGCAGATGG - Intergenic
1019273749 7:165017-165039 GGATGTGCCCAGAAGGCGGAGGG + Intergenic
1019305905 7:335645-335667 ACAGGTGCACAGAAGGCACTGGG + Intergenic
1019312737 7:370611-370633 CAAAGTCCACAGGAGGCAGATGG - Intergenic
1020118984 7:5492230-5492252 CCATGCAGACAGAAAGCAGAAGG + Intronic
1020260735 7:6529497-6529519 CCAACTGCACAGATGGAAGAAGG + Intronic
1021367738 7:19801667-19801689 CCATGTCCTCACATGGCAGAAGG - Intergenic
1021782438 7:24119197-24119219 AAATGTCCACAGAAGCCAGAAGG - Intergenic
1022022995 7:26419107-26419129 CTCTGTGCGCAGAAAGCAGACGG - Intergenic
1023374058 7:39538686-39538708 CCATGTGGACAGTAGACAAAGGG - Intergenic
1025732143 7:64116483-64116505 CCAAGTCTACAGCAGGCAGAAGG + Intronic
1026297888 7:69071397-69071419 CCATGGACACAGATGGAAGAGGG - Intergenic
1027454534 7:78373070-78373092 CCAGGTACTCAGAAGGCTGAGGG - Intronic
1028595784 7:92545546-92545568 CGATGTGCCCAGATTGCAGATGG - Intergenic
1029677750 7:102082156-102082178 TCCTTTGCACAGCAGGCAGACGG + Intronic
1030110311 7:106021288-106021310 CCAAGGGCACAGCAGGCAGCAGG - Intronic
1031255207 7:119438082-119438104 GCATGTGGTCACAAGGCAGATGG + Intergenic
1032090995 7:128911499-128911521 CCCTGGGCTCAGCAGGCAGAGGG + Intergenic
1032760045 7:134932161-134932183 CTAGGTGCAAAGAAGGGAGAGGG + Intronic
1032850555 7:135791572-135791594 CCTTGTGCACAGAAGTCCCAGGG + Intergenic
1032850856 7:135793917-135793939 CCATGTTCAAAGTAGGAAGAAGG + Intergenic
1032856029 7:135834315-135834337 TCATGAGCAGAGAAGGAAGAAGG + Intergenic
1033917995 7:146351203-146351225 TCATGTGAACAGAAGACTGAGGG + Intronic
1034116476 7:148588429-148588451 CCACATGCACAGAATACAGAAGG - Intergenic
1034558537 7:151865074-151865096 TCATGTGCACAGGGGCCAGAAGG - Intronic
1034678398 7:152909466-152909488 CCATGTGAAGAGACGGCACAGGG + Intergenic
1036727301 8:11231413-11231435 CCATGGACACAAAATGCAGAGGG - Intergenic
1037817256 8:22118788-22118810 ACAGGTGCAGAGAAGGCAGAGGG - Intronic
1037834653 8:22208873-22208895 CCAGGTGCACAAAAGCCAGAGGG + Intronic
1038473106 8:27842179-27842201 CCATGTGCACAGTAAGGAGAAGG + Intergenic
1038975254 8:32688141-32688163 CCATGTGAAAACAAGGCATAAGG + Intronic
1041165746 8:55090739-55090761 CCCTGTCCAAAGAAGGCACATGG + Intergenic
1042113309 8:65404660-65404682 CCATGTACACATAAGACACAAGG + Intergenic
1042799454 8:72702907-72702929 CGCAGTGCACAGAAAGCAGATGG - Intronic
1043530808 8:81147979-81148001 TCATGTGCTGAGAAGGCAAACGG - Intergenic
1044825219 8:96189550-96189572 AGATGAGCACACAAGGCAGAGGG - Intergenic
1045064247 8:98431503-98431525 CCAGCTGCACTGAAGGCAGGTGG + Exonic
1045140987 8:99282145-99282167 CCATGTGCAGGGAAGAAAGAAGG - Intronic
1045290197 8:100826308-100826330 CCCTGTGCTCAGCAGGCAGCCGG - Intergenic
1045455469 8:102374672-102374694 CTATGTGTGCAGAAGGCAGTAGG - Intronic
1047253701 8:123199973-123199995 CCATTTCCACACAAGACAGATGG + Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048313201 8:133342153-133342175 CCATCTGCAAAGCAGGCACAGGG + Intergenic
1048590477 8:135816590-135816612 ACAGGGGCACAGAAGGGAGAAGG + Intergenic
1049044554 8:140139150-140139172 CAATGGGCACAGAAGGCTGAGGG + Intronic
1049302341 8:141878287-141878309 CACTGTGCAGAGAAGGCTGAGGG - Intergenic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1052173378 9:25428063-25428085 CCATATGCACAGACATCAGAAGG + Intergenic
1052735242 9:32335091-32335113 GCCTGTGCACAGATGACAGAGGG - Intergenic
1052745507 9:32436376-32436398 CGATTTCCCCAGAAGGCAGATGG - Exonic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1056326769 9:85486599-85486621 CCATGTGGAGATAAAGCAGAGGG + Intergenic
1056519751 9:87389296-87389318 CTTTGTGCAAAGCAGGCAGAGGG - Intergenic
1056640810 9:88368851-88368873 CCGTGTGCACATTAGGAAGATGG + Intergenic
1056756316 9:89384204-89384226 CACTGTTCACAGAAGCCAGAAGG + Intronic
1056826182 9:89877900-89877922 CAGTATGCACAGAAGGCAAACGG - Intergenic
1057989702 9:99755782-99755804 CCATGGGCCCAGGAGGCAGTTGG + Intergenic
1058172069 9:101693686-101693708 CCATGTGCACACTGGGCAGCAGG - Intronic
1058568884 9:106319259-106319281 ACATGTGGACAGAAGCCAAATGG - Intergenic
1059172307 9:112137203-112137225 CCATGTGCTCAGAAAGGAGCAGG + Intronic
1059343671 9:113613822-113613844 CCATGGGGAGAGAAGGTAGATGG - Intergenic
1059635469 9:116166175-116166197 CCCTGAGCAAAGAAGTCAGAAGG + Intronic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1061364884 9:130167354-130167376 CAATCTGCACAGCAGCCAGAAGG + Intergenic
1062004496 9:134232348-134232370 CCATGAGCTCAGGAGGCAGCAGG - Intergenic
1062192825 9:135256486-135256508 CCAGGTGGAGAGGAGGCAGAGGG - Intergenic
1062405299 9:136393349-136393371 CCATGAGCTCTCAAGGCAGAGGG - Intronic
1062732046 9:138115533-138115555 CCATCTGCAAAGGAGGCAAAGGG - Exonic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1186126700 X:6422236-6422258 GCCTGTGCACAGCAGCCAGATGG + Intergenic
1190164027 X:48056713-48056735 CCATGTCCTCACATGGCAGAAGG - Intronic
1191640833 X:63428723-63428745 CCATAAGCAGAGAAGGCAAAAGG + Intergenic
1191650826 X:63536350-63536372 TCATGGGCACAGAAAGTAGAAGG + Intergenic
1193250841 X:79289081-79289103 CCATGTGCATAGTAGACAGCAGG + Intergenic
1194470849 X:94294577-94294599 GGATGTGCACAGAAGTCATATGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195246837 X:103002597-103002619 CCATGTGCACAGCACACAGTAGG + Intergenic
1195371392 X:104178247-104178269 GCATGAGCCCAGGAGGCAGAGGG - Intronic
1198430000 X:136555929-136555951 TAATGTGCAGAGAAGGCAAATGG + Intronic
1199329020 X:146536937-146536959 CCATATGCAAAGAATGCAGTCGG + Intergenic
1199785329 X:151100132-151100154 CCATGCACAGAGAAGGCAGCTGG + Intergenic