ID: 1063612828

View in Genome Browser
Species Human (GRCh38)
Location 10:7577183-7577205
Sequence GGTTGAACACCATTGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063612822_1063612828 15 Left 1063612822 10:7577145-7577167 CCCACACAATATTTCTGCCAGGA 0: 1
1: 0
2: 1
3: 18
4: 158
Right 1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1063612819_1063612828 27 Left 1063612819 10:7577133-7577155 CCAACATGGCACCCCACACAATA 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1063612820_1063612828 16 Left 1063612820 10:7577144-7577166 CCCCACACAATATTTCTGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1063612823_1063612828 14 Left 1063612823 10:7577146-7577168 CCACACAATATTTCTGCCAGGAG 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 135
1063612825_1063612828 -2 Left 1063612825 10:7577162-7577184 CCAGGAGATCACTAGGCAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 153
Right 1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063612828 Original CRISPR GGTTGAACACCATTGGTGAG AGG Intronic
905366846 1:37456791-37456813 GCTTGCATACCATTGGTGATGGG + Intergenic
906181780 1:43827043-43827065 TGTTGAACAGGAGTGGTGAGAGG - Intronic
907881966 1:58558224-58558246 GGTTGCAAAGCAGTGGTGAGAGG - Intergenic
910039311 1:82829266-82829288 GGTTGAAGATCATGGGTCAGTGG - Intergenic
911700445 1:100946322-100946344 TGTTGAACAGGAGTGGTGAGAGG + Intronic
911934771 1:103955541-103955563 TGTTGAAAAACAGTGGTGAGGGG + Intergenic
914931741 1:151940795-151940817 GGTTGAGAATCATTGGTCAGTGG + Intergenic
917270002 1:173262436-173262458 GGTTGAATAGGAGTGGTGAGAGG - Intergenic
917280769 1:173376456-173376478 GGATGGATACCATTAGTGAGAGG + Intergenic
917625644 1:176843326-176843348 GTGTGAATACCATTGGTGATGGG + Exonic
919590956 1:199501550-199501572 TGTTGAACAGGAGTGGTGAGAGG - Intergenic
920369350 1:205468225-205468247 GGTTGAACACCAGTGTGGTGAGG + Intergenic
924020955 1:239781652-239781674 TGTTGAAAAGCAGTGGTGAGCGG + Intronic
1063612828 10:7577183-7577205 GGTTGAACACCATTGGTGAGAGG + Intronic
1068819631 10:61359451-61359473 GGTTGGACACCATTAATTAGAGG - Intergenic
1069510950 10:69042163-69042185 GGTTGAAAACTATTGGATAGAGG + Intergenic
1069585604 10:69599249-69599271 TGTTGAACAGGAGTGGTGAGAGG + Intergenic
1069796877 10:71059309-71059331 GCCTGGACACCATTAGTGAGTGG + Intergenic
1071214648 10:83386113-83386135 TGTTGAATACCATTGGTTAATGG + Intergenic
1074675646 10:115847591-115847613 TGTTATACATCATTGGTGAGAGG + Intronic
1079065622 11:17288778-17288800 GGTGGATCACCATAGGTCAGGGG - Intronic
1083227338 11:61293623-61293645 GGTGGAACACCATTGGGAAGGGG - Intronic
1084015774 11:66380138-66380160 TGTTGAAAAGCAGTGGTGAGAGG + Intergenic
1088336394 11:108709123-108709145 TGTTGGACAGCAGTGGTGAGAGG + Intronic
1090995794 11:131864753-131864775 GTTTGAACACAACTGGTGAGAGG + Intronic
1091126034 11:133098776-133098798 GGATGAAAAGCAGTGGTGAGAGG - Intronic
1092436695 12:8453273-8453295 AGTTTAAAACCATTGTTGAGAGG + Intergenic
1093616311 12:21229898-21229920 TGTTGAAAAACAGTGGTGAGAGG + Intronic
1095661090 12:44737626-44737648 GGTTGATCACAATTGTTGTGTGG - Intronic
1097081015 12:56430911-56430933 GGTTGAAATCCATTGGGGAGAGG - Exonic
1100017814 12:90033159-90033181 TGTTGAAAAGCAGTGGTGAGAGG + Intergenic
1101556134 12:105811643-105811665 GATTGAAAATCATTGGTGTGGGG + Intergenic
1108113863 13:47106721-47106743 TGTTGAACAGGAGTGGTGAGAGG - Intergenic
1116667694 14:47798597-47798619 TGTTGAACAGGAGTGGTGAGAGG - Intergenic
1116723506 14:48531183-48531205 TGTTGAAAACAAGTGGTGAGAGG + Intergenic
1119002381 14:70894219-70894241 GGTTGCAAACCATTGCTGATAGG + Intergenic
1119579880 14:75768371-75768393 GGTGGAAGACCAGTTGTGAGTGG + Intronic
1119927940 14:78514777-78514799 GGTCAAACACCATTGTAGAGAGG + Intronic
1123939159 15:25208438-25208460 CGTTGACCAGCATAGGTGAGTGG + Intergenic
1126974265 15:54157078-54157100 GCTTGTACTCAATTGGTGAGAGG - Intronic
1127393786 15:58527536-58527558 AGATGAACTCCATTGGTGGGTGG - Intronic
1128556456 15:68635173-68635195 GGTTCAAGACCAGTGGGGAGAGG - Intronic
1129543622 15:76372227-76372249 GTTTGAAGATCCTTGGTGAGAGG - Intronic
1131869588 15:96748072-96748094 GGTTAAACAACAATGGTGAGCGG + Intergenic
1132196798 15:99919622-99919644 GTTTGAGGGCCATTGGTGAGTGG - Intergenic
1134863308 16:17580677-17580699 TGTTGAATACCATTGGTGAAAGG - Intergenic
1136075243 16:27812652-27812674 GGTTGAAAACCACTGGTGCAGGG + Intronic
1139326108 16:66153807-66153829 GTTTGAACACCTCTTGTGAGGGG - Intergenic
1143649511 17:8254902-8254924 GGCTGAAAGCCAATGGTGAGGGG + Intronic
1143865361 17:9919157-9919179 TGTTGTTCACCCTTGGTGAGAGG + Intronic
1149233139 17:54559413-54559435 AGTTGAGAAACATTGGTGAGAGG - Intergenic
1150313425 17:64148285-64148307 GGTTGTACCTCATTGGTGAAAGG + Exonic
1153792479 18:8592005-8592027 AGTTGAAAAGCAGTGGTGAGAGG - Intergenic
1154215340 18:12411761-12411783 AGTGGAACACCAGTGGGGAGGGG - Intronic
1155720611 18:29007067-29007089 GGTTGTAAACCTTTAGTGAGAGG + Intergenic
1157709678 18:49841599-49841621 GGTTGAGACCCATTGCTGAGAGG + Intronic
1159487145 18:69076718-69076740 TGTTGAACAGCAGTGGTGAGAGG - Intergenic
1168024940 19:53637228-53637250 GGCTGATCACCATTGGCCAGTGG + Intergenic
925627780 2:5858890-5858912 TGTTGAACAGGAGTGGTGAGAGG + Intergenic
927441547 2:23121990-23122012 GGGTGATCACAGTTGGTGAGTGG + Intergenic
932646330 2:73506815-73506837 TGTTGAATAGCAGTGGTGAGAGG + Intronic
935506416 2:103910179-103910201 TGTTGAAAATGATTGGTGAGAGG + Intergenic
940852007 2:158696692-158696714 TGTTGAAAATCAGTGGTGAGAGG - Intergenic
944105265 2:196072794-196072816 TGTTGAAGACCTTTGGAGAGTGG - Intergenic
944572407 2:201058003-201058025 TGTAGATCAGCATTGGTGAGGGG - Intronic
945145192 2:206730888-206730910 TGTTGAACAGGAGTGGTGAGAGG - Intergenic
946249529 2:218404169-218404191 GTTTGAACACTGTGGGTGAGGGG + Intronic
946276044 2:218632669-218632691 GCTTGAAAACCAGTGATGAGCGG + Intronic
1171384474 20:24760586-24760608 TGTTGAAAAACAGTGGTGAGAGG - Intergenic
1173221281 20:41135073-41135095 GGTTAATCAGCATGGGTGAGGGG - Intergenic
1175654112 20:60753755-60753777 GGTCCAAAACCAATGGTGAGTGG - Intergenic
1176548296 21:8211213-8211235 CGTTGAACCCCATTCGTGATGGG + Intergenic
1176556192 21:8255421-8255443 CGTTGAACCCCATTCGTGATGGG + Intergenic
1176567227 21:8394248-8394270 CGTTGAACCCCATTCGTGATGGG + Intergenic
1176575126 21:8438458-8438480 CGTTGAACCCCATTCGTGATGGG + Intergenic
1177933255 21:27312103-27312125 TGTTGAATAGCAGTGGTGAGAGG + Intergenic
1180342819 22:11631128-11631150 TGTTGAACCCCATTCGTGATGGG + Intergenic
1181084364 22:20432480-20432502 GGTTGAGCTCCAGTGGGGAGGGG + Intronic
1183383758 22:37503417-37503439 GGTGGAACAACATTGGACAGAGG - Intronic
1203253175 22_KI270733v1_random:127513-127535 CGTTGAACCCCATTCGTGATGGG + Intergenic
1203261230 22_KI270733v1_random:172594-172616 CGTTGAACCCCATTCGTGATGGG + Intergenic
950322642 3:12070832-12070854 GCTTCAACACCATGGCTGAGTGG + Intronic
953551144 3:43904391-43904413 GTTTGCACACTACTGGTGAGAGG + Intergenic
955635384 3:61022948-61022970 TGTTGAATAGCAGTGGTGAGAGG - Intronic
962083462 3:132165529-132165551 GGTAGAACAACTTTGGTTAGGGG - Intronic
962512735 3:136118332-136118354 TGTTGAATACGAGTGGTGAGAGG - Intronic
966786856 3:183630244-183630266 AGTTGAAAAGCATTGGTGAATGG - Intergenic
969573730 4:8024679-8024701 GGGTGAACACAATTTGTGAACGG + Intronic
972723563 4:41725358-41725380 TGTTGAAAAGCAGTGGTGAGGGG + Intergenic
975746912 4:77483863-77483885 GGTTGTACAACAGTGATGAGTGG - Intergenic
977374885 4:96189860-96189882 AGTTAAAAACCATTGATGAGAGG + Intergenic
978135509 4:105253675-105253697 TGTTGAAAGGCATTGGTGAGAGG + Intronic
981877488 4:149565098-149565120 AGTGGAACTCCATTTGTGAGAGG - Intergenic
982533275 4:156575157-156575179 TGTTGAACATCATTGATCAGTGG + Intergenic
983647930 4:170010822-170010844 GCTTGAACAACATGGGTTAGGGG - Intronic
990552892 5:56901724-56901746 GTTTGAAAACCACTGGTGTGAGG - Intergenic
990921032 5:60967375-60967397 TGTTGAATACAAGTGGTGAGAGG + Intronic
992236087 5:74710393-74710415 TGTTGAACAGGAGTGGTGAGAGG - Intronic
996051030 5:118933737-118933759 GATTGAATAGCAGTGGTGAGAGG - Intronic
996592860 5:125167291-125167313 TGTTGAAAAGCAGTGGTGAGAGG - Intergenic
1000913844 5:167055944-167055966 TGTTGAAGAGCAGTGGTGAGAGG + Intergenic
1001462575 5:171930381-171930403 TGTTGAAAACCAGTGTTGAGAGG - Intronic
1002044180 5:176532849-176532871 GGCTGAACACCATTGGTCCCTGG - Intronic
1002667591 5:180837160-180837182 GCTTGCAAAGCATTGGTGAGTGG + Intergenic
1002758549 6:183906-183928 GGTTGAACTTCATGGGTGGGTGG - Intergenic
1006672765 6:35739822-35739844 CTTTGAACCCCATTGGTCAGAGG + Intronic
1010496913 6:76544927-76544949 TGTTGAAAACCAGTGGTGTGAGG + Intergenic
1011094140 6:83639312-83639334 GTTTGAATACCAGTGTTGAGTGG - Intronic
1017208709 6:151831637-151831659 GATTGTACAACTTTGGTGAGTGG + Intronic
1017661055 6:156673464-156673486 TGTTGAAAATCAGTGGTGAGAGG - Intergenic
1020425870 7:8065440-8065462 TGTTGAACAGGAGTGGTGAGAGG + Intronic
1023205599 7:37746050-37746072 AATTGAACATCATTGGAGAGGGG - Intronic
1024848457 7:53679468-53679490 TGTTGAATACAAGTGGTGAGAGG + Intergenic
1024964529 7:55011556-55011578 TGTTGAAAAGCATTGGTGAAAGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1027334717 7:77137214-77137236 GGTTGAAAAGGAGTGGTGAGAGG - Intronic
1028004335 7:85543330-85543352 TGTTGAAAACTAGTGGTGAGAGG + Intergenic
1029036689 7:97529666-97529688 AGTTGATCACCAATGGTAAGTGG - Intergenic
1029781084 7:102733888-102733910 GGTTGAAAAGGAGTGGTGAGAGG + Intergenic
1030180246 7:106699953-106699975 TGTTGAAAAGCAGTGGTGAGAGG + Intergenic
1030403966 7:109087273-109087295 TGTTGAACAGGAGTGGTGAGAGG - Intergenic
1031039419 7:116823360-116823382 TGTTGAACAGGATTGGTGAGAGG + Intronic
1033122143 7:138675752-138675774 GGCCCAACACCATTGTTGAGTGG + Intronic
1040420314 8:47233516-47233538 GGTTGAAAAGGAATGGTGAGAGG - Intergenic
1040520259 8:48170447-48170469 TGTTGAATAGGATTGGTGAGAGG + Intergenic
1040793665 8:51265297-51265319 TGTTGAAAACCAGTGGTGAGAGG + Intergenic
1041483341 8:58347056-58347078 GCTTGAGTACCATTGGTGAAAGG + Intergenic
1043554410 8:81414259-81414281 TGTTGAACAGAAGTGGTGAGAGG - Intergenic
1046587562 8:116166720-116166742 GGTAGAACACCATTGTTTAGAGG - Intergenic
1049692769 8:143969853-143969875 GGGTGAGTACCGTTGGTGAGTGG + Intronic
1050030620 9:1381668-1381690 GCTAGAACAACATTGGTGAGTGG - Intergenic
1050694791 9:8266709-8266731 GGTTGAACACTAGGGATGAGAGG - Intergenic
1051116611 9:13701376-13701398 GGTTGAAAAGCAGTGGTGAAAGG + Intergenic
1051157237 9:14162943-14162965 GCTTTAACACCGTTGGAGAGAGG - Intronic
1053460945 9:38271030-38271052 GGTACAACACAATTGTTGAGGGG - Intergenic
1055980258 9:81993912-81993934 GATTGAAGAGCATTGGTGACAGG - Exonic
1056056790 9:82833028-82833050 GGTGGAACAGCAATGGAGAGTGG + Intergenic
1057036736 9:91816831-91816853 GGCTGAAAACCAATGGTGAGTGG - Intronic
1058670853 9:107359396-107359418 GGTTGAACAGCTTTGGGGAGTGG + Intergenic
1203469577 Un_GL000220v1:110660-110682 CGTTGAACCCCATTCGTGATGGG + Intergenic
1203477398 Un_GL000220v1:154632-154654 CGTTGAACCCCATTCGTGATGGG + Intergenic
1203360942 Un_KI270442v1:218719-218741 TGTTGAACCCCATTCGTGATGGG - Intergenic
1188350252 X:29121193-29121215 TGTTGAAAAGCAGTGGTGAGTGG - Intronic
1189446085 X:41083504-41083526 TATTGAACAGAATTGGTGAGAGG + Intergenic
1189547953 X:42062356-42062378 GCTTGAACACTATTGGTGTATGG + Intergenic
1193727593 X:85060916-85060938 TGTTGAACAGGAGTGGTGAGAGG + Intronic
1197148695 X:123196048-123196070 GGTACATCACCATTGGTGGGGGG + Intronic
1201601962 Y:15739595-15739617 AGTTGAAGAGCATTGGTGATGGG + Intergenic