ID: 1063614172

View in Genome Browser
Species Human (GRCh38)
Location 10:7588008-7588030
Sequence CAAGTTGGACAGTGGAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063614172 Original CRISPR CAAGTTGGACAGTGGAATGT GGG (reversed) Intronic
903843161 1:26259014-26259036 CAATTTGGGCATTTGAATGTTGG + Intronic
903875103 1:26468772-26468794 GAAGTGGAACAGTGGAAAGTAGG - Intronic
904555036 1:31356034-31356056 TGAGTTGGACAGTGGAGAGTAGG + Intronic
906295936 1:44649170-44649192 CAAGGGGGACATTGGAATGTTGG + Intronic
907235701 1:53044982-53045004 TAACCTGGACAGTGGAATTTTGG - Intronic
907256969 1:53186716-53186738 CAGGTAGGACAGGGGACTGTGGG - Intergenic
907492748 1:54819283-54819305 GGAGGTGCACAGTGGAATGTAGG - Intronic
908379138 1:63578091-63578113 CAAGTTGGAAAAATGAATGTGGG + Intronic
908673594 1:66576332-66576354 GTAGTTGAACAGTGTAATGTGGG + Intronic
910522375 1:88137186-88137208 TAACTTGGAGAGTGGAATCTGGG - Intergenic
911064086 1:93772268-93772290 CAAGTTGGAGAGAGGATTGGAGG + Intronic
918940762 1:190993419-190993441 CAAGATGGACAGTGGCATTGTGG + Intergenic
920383349 1:205548749-205548771 CAAGCTGCACAGTGGAAGCTGGG + Intergenic
920436447 1:205950031-205950053 CCAGTTGGAGAGTGGAGTTTAGG - Intergenic
921979535 1:221240863-221240885 CAAGTTGGCAAGTGGGATTTAGG + Intergenic
1063143423 10:3275480-3275502 CATGGTGGACAGTAGATTGTGGG + Intergenic
1063614172 10:7588008-7588030 CAAGTTGGACAGTGGAATGTGGG - Intronic
1063970186 10:11376383-11376405 CAACTTTGAGAGTGGAATGGTGG - Intergenic
1064002532 10:11675379-11675401 GAGGTTGGAAAGTGCAATGTAGG + Intergenic
1070416871 10:76198648-76198670 AAAGTTGGAGGGTGGAATGAAGG + Intronic
1070786392 10:79164781-79164803 CCACTTGGACAGTGGATTTTGGG + Intronic
1071221010 10:83464375-83464397 CAAGGAGGACAGAGGAATGTAGG - Intergenic
1072191091 10:93076573-93076595 CAAGTTGGACATGGAAATTTTGG + Exonic
1072762970 10:98073014-98073036 AAAAATGGACAGAGGAATGTGGG + Intergenic
1073653231 10:105383740-105383762 CAAGTTTGACGGTGGCATGCAGG + Intergenic
1076886078 10:133263075-133263097 CTAGCTGGACCGTGGAATGCTGG + Exonic
1077500335 11:2907150-2907172 CAAGGGGGACAGTGGAAAGAAGG + Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1081567714 11:44270152-44270174 CATGTGGGGGAGTGGAATGTGGG + Intronic
1081783413 11:45729264-45729286 CTAGTTGGACACTGGAAGGCAGG - Intergenic
1081955079 11:47084996-47085018 CATGTTGGTCAGGGGCATGTTGG - Intronic
1083689799 11:64400420-64400442 CAAGGTGTCCAGTGGAAAGTGGG + Intergenic
1084523723 11:69683070-69683092 CAAGTTAGACAGTGAAAAGTAGG - Intergenic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1092506385 12:9105225-9105247 TAAGTTTGCCAGTGAAATGTTGG + Intronic
1094415347 12:30209900-30209922 CAAAGTGGACAATGGATTGTAGG + Intergenic
1101250514 12:102929634-102929656 CAAGGTGGAGAGTGGAATGGAGG + Intronic
1101442371 12:104713318-104713340 AAAGTGAGACAGTGGATTGTAGG + Intronic
1102612660 12:114126298-114126320 CAAGTTAGACACTAGAATCTAGG + Intergenic
1104780691 12:131418002-131418024 CAAGTTTGAGAGGGGAATGCAGG - Intergenic
1106067721 13:26372551-26372573 AAAGTTGTACATTGAAATGTAGG + Intronic
1107813597 13:44223797-44223819 GAAGTTAGACAGTGGAATGGAGG + Intergenic
1108367954 13:49735928-49735950 CAAGGTGGAAAGAGGAATTTGGG - Intronic
1110212474 13:72989834-72989856 GAAGTTGCGCAGTGGAAAGTGGG + Intronic
1110244524 13:73306916-73306938 CAGGTTGGATATTGGAGTGTGGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112111220 13:96301407-96301429 CAGGTTGTAAAGGGGAATGTAGG + Intronic
1112183211 13:97105173-97105195 AATGCTGGACAGTGGAATATTGG - Intergenic
1112600210 13:100847773-100847795 CATGTTGGCCAATGGAATGTGGG - Intergenic
1113677966 13:112221495-112221517 GAAGTTGGAGAACGGAATGTAGG - Intergenic
1114308422 14:21443930-21443952 CTGGTTTGACAGTGGAAAGTAGG - Intronic
1114458691 14:22873292-22873314 CAAGCTGGAGAGAGGAAGGTAGG - Exonic
1117210763 14:53496496-53496518 CAGGTTTGACAGAGGAATGGAGG - Intergenic
1117378122 14:55134225-55134247 CAAGTTGGAGTGTGGTATGCTGG + Intronic
1120293059 14:82601918-82601940 CAAGTTTTACAGTGGTTTGTTGG + Intergenic
1123813713 15:23955196-23955218 CAAGGCTGACACTGGAATGTGGG + Intergenic
1126469998 15:48999132-48999154 CAGAATGGACAGGGGAATGTAGG + Intronic
1126645359 15:50869930-50869952 CAGGTTGGAAAGAGGAGTGTGGG + Intergenic
1126729800 15:51671346-51671368 CAAGGTGGACAGTGGAAGTTAGG - Intergenic
1129278296 15:74462052-74462074 CAGGTCGCACATTGGAATGTGGG - Intergenic
1138802698 16:60053639-60053661 CAAGATTGAAAGTGGAGTGTGGG + Intergenic
1139122453 16:64036970-64036992 CCAGTTTGGCAGTGGAATGCAGG + Intergenic
1140418559 16:74796406-74796428 CAGTCTGGCCAGTGGAATGTTGG - Intergenic
1140597451 16:76433237-76433259 CAAGTTGAACACTAGAATGATGG - Intronic
1140936936 16:79680854-79680876 GAGGTTGGACAGTGGGAGGTGGG + Intergenic
1140990323 16:80204901-80204923 GAAGGTAGACAGAGGAATGTGGG - Intergenic
1143178655 17:4970808-4970830 CAGGTAGGACAGTGGATGGTTGG - Intronic
1148198410 17:45731327-45731349 CAAGAGGGAGAGTGGATTGTAGG + Intergenic
1148316729 17:46707566-46707588 AAAGATGGACAGTAGAATGGTGG - Intronic
1148745483 17:49915817-49915839 CAGGATGGACAGAGGAATGCTGG - Intergenic
1148840711 17:50494991-50495013 CAAGAGGGACAGTCTAATGTTGG + Intergenic
1150647227 17:66986426-66986448 GAATTAGGACAGTGGAATGGAGG + Intronic
1150755753 17:67911130-67911152 CAAGTTGGAGGGTGGAATTAAGG + Exonic
1155236370 18:23823519-23823541 CAGTTTGGACAGTGGTATTTGGG - Intronic
1156576351 18:38320726-38320748 CAGCTAGGACAGTGTAATGTTGG + Intergenic
1160532263 18:79572329-79572351 CAAGTTGAAGAGGGGTATGTGGG + Intergenic
1160845112 19:1162874-1162896 CCAGTTGGAGTCTGGAATGTGGG - Intronic
1162975286 19:14204822-14204844 CATGTTGGGAAGTGGGATGTGGG + Intronic
1166796235 19:45428012-45428034 CAAGTTGGCAAGTTGGATGTTGG + Intronic
1168670038 19:58234104-58234126 CAGGCTGGAGAGTGGACTGTGGG - Intronic
924979079 2:203880-203902 CAATTTGGGCAGTGGGTTGTGGG + Intergenic
926273555 2:11386355-11386377 GAAGTGGGAAAGTGGAATGGAGG - Intergenic
929887363 2:45890920-45890942 CTAGTTGGACCTTGGAATGTTGG + Intronic
931376342 2:61711907-61711929 TCAGGTGGACAGTGGTATGTGGG - Intergenic
932303811 2:70687275-70687297 CAAGTTGGTCAGGGGCAGGTAGG - Intronic
932430823 2:71672714-71672736 CAAGCTGGCCAGAGGAATGGAGG + Intronic
932440345 2:71730938-71730960 CAAGGTGGAATGTGGGATGTGGG - Intergenic
936011381 2:108927419-108927441 GAAGTTGGACACTGGAAGGGTGG - Intronic
939572547 2:143857529-143857551 CTATTTGGACAATGGAAGGTAGG - Intergenic
945126819 2:206521020-206521042 CAATTTGGACAGGGAAATATGGG - Intronic
945557852 2:211301307-211301329 CAAGTTGAACAATTGTATGTGGG + Intergenic
946420474 2:219561839-219561861 GAGGTGGGACAGAGGAATGTGGG + Intronic
947344348 2:229175112-229175134 CAATTTGGACAGGGCTATGTGGG - Intronic
1168886517 20:1263210-1263232 CAAGTTCAACTGTGGAAAGTAGG - Intronic
1171044793 20:21799832-21799854 CACGTTGCACTGTGGAATTTGGG - Intergenic
1172233303 20:33351853-33351875 CAAGATGGGCTTTGGAATGTGGG + Intergenic
1172611275 20:36254476-36254498 AGAGTTGGAAAGTAGAATGTGGG + Intronic
1173533770 20:43792431-43792453 CCAGTTGGAAGTTGGAATGTGGG + Intergenic
1173715483 20:45199891-45199913 CAAGTGGGTGAGTGGGATGTGGG + Intergenic
1177223410 21:18222420-18222442 CAACTTGGACACTGAAAGGTGGG + Intronic
1177239017 21:18432170-18432192 CAAGTAGGAAAGAGGAATGGAGG - Intronic
1182779544 22:32856842-32856864 AAAGATGGACAGTGGATTGGTGG - Intronic
1183015964 22:34986960-34986982 GAAGTTGGACACTGGAATAATGG + Intergenic
1184566070 22:45292990-45293012 AAAGTTGGAAAGTGGAATGTGGG + Intronic
950978676 3:17278119-17278141 CAAGTTTACCAGAGGAATGTGGG + Intronic
951511062 3:23502597-23502619 AAAATTGGGCAGTGGAATATAGG - Intronic
953931338 3:47007348-47007370 CAAGTAGGACAGAGGGCTGTGGG + Exonic
955799331 3:62669595-62669617 GAACTTGGACAGTGGAGTGGGGG - Intronic
956843127 3:73158107-73158129 CAAGGAGGACTGAGGAATGTTGG + Intergenic
960063531 3:113348002-113348024 CAAGGAGGACAGAGGAAGGTTGG - Intronic
961137961 3:124529591-124529613 CAAGGTGGACAGTGGAACCCAGG + Intronic
961269897 3:125680753-125680775 CAAGGAGGACACTGGACTGTAGG + Intergenic
961624794 3:128254474-128254496 CATGTTGGACAGGGAAATGGGGG + Intronic
963679997 3:148362274-148362296 CAAGTTGTACATTGGGATTTGGG + Intergenic
974803409 4:66848730-66848752 CAAATGGGACAGCAGAATGTTGG + Intergenic
975047851 4:69826405-69826427 CAAGGAGGACCGAGGAATGTTGG - Intronic
975567112 4:75769075-75769097 CATGTTGCACAGAGGAGTGTGGG - Intronic
976589617 4:86836016-86836038 CACCTTGGAAAGTGAAATGTGGG + Intronic
979069664 4:116185961-116185983 CACGTGGGACAGTTGAATATTGG - Intergenic
983573590 4:169236228-169236250 CACTTTGGACAATGAAATGTGGG + Intronic
983818991 4:172170078-172170100 CAACTTAGATTGTGGAATGTGGG - Intronic
986772023 5:10982966-10982988 GAAGATGGACAGTAGAATGATGG + Intronic
993013979 5:82514841-82514863 CAAGAAGGACTGTGGCATGTTGG + Intergenic
994190083 5:96859546-96859568 CAAGCTGCACAGTGCAATGTGGG + Intronic
994231886 5:97316693-97316715 CAAGGAGGACCGAGGAATGTTGG + Intergenic
994735240 5:103545717-103545739 ACAGTTGGACAGAGAAATGTGGG + Intergenic
1004114424 6:12751936-12751958 TAAGTTGGACAGTGGAGGGATGG + Intronic
1004197447 6:13517750-13517772 CAACTTGGACAGATAAATGTTGG - Intergenic
1005802142 6:29437453-29437475 CAAGTGGGAAAGTTGAATATGGG - Intronic
1012537767 6:100319879-100319901 GAAGGTGGATAGTGGAATGGTGG - Intergenic
1016129341 6:140446545-140446567 CTACTTGGACAGTGGATTGATGG + Intergenic
1018619089 6:165713410-165713432 CCAGTTAGACAGTGGCATGTGGG + Intronic
1021001630 7:15338902-15338924 CAATGTGGACAGTAGAAGGTTGG + Intronic
1022373732 7:29793776-29793798 CCAGCTGAGCAGTGGAATGTAGG - Intergenic
1023911608 7:44560534-44560556 CAAGTTGTACAGTGAGCTGTGGG + Intergenic
1025828455 7:65030019-65030041 CAATGTGGACTGTGGACTGTGGG + Intergenic
1025915978 7:65866450-65866472 CAATGTGGACTGTGGACTGTGGG + Intergenic
1029374158 7:100167921-100167943 AAGGTTGGAAAGTGGAATGGTGG - Intronic
1030420348 7:109300684-109300706 CAAGGAGGACCGAGGAATGTTGG - Intergenic
1030902648 7:115143443-115143465 CAATTTGGCCAGTGAAATCTGGG + Intergenic
1032095396 7:128935647-128935669 CAAGATGGACAGTGGGAAGGGGG + Intergenic
1034831184 7:154309158-154309180 CAAGTTAGCCAGTGGAATGTAGG - Intronic
1036977223 8:13427262-13427284 CGAGTTGGACAGAGAACTGTGGG - Intronic
1038397813 8:27259990-27260012 AAGGCTGGACGGTGGAATGTGGG - Intergenic
1039170128 8:34735250-34735272 GAAGGTAGACAGTAGAATGTTGG + Intergenic
1040914538 8:52555626-52555648 CAATTAGGGCAGAGGAATGTTGG - Intronic
1042745982 8:72106499-72106521 CATGTTGGAGAATGCAATGTTGG + Intronic
1042808304 8:72795977-72795999 CAAGTTGGACAATGGTTTCTGGG - Intronic
1044617114 8:94153850-94153872 GAACTTGGAGAGTAGAATGTTGG + Intronic
1045251335 8:100485555-100485577 CAAGTTGGAGTGTGGAGTGTGGG + Intergenic
1046625020 8:116567607-116567629 CCAGATGGACAAGGGAATGTAGG - Intergenic
1047193220 8:122697607-122697629 CAAGATGCACGGTGAAATGTTGG - Intergenic
1049161025 8:141097691-141097713 GAAGGTGGAGAGTAGAATGTTGG - Intergenic
1051111227 9:13639114-13639136 AGAATAGGACAGTGGAATGTTGG + Intergenic
1051935103 9:22436110-22436132 CAAGGAGGACAGAGGAAGGTGGG - Intergenic
1055554809 9:77463162-77463184 CAAAAGTGACAGTGGAATGTGGG + Intronic
1057554739 9:96078733-96078755 GAAGTTGGACGGTGGGATGTTGG - Intergenic
1186565217 X:10655080-10655102 CAAGTTGGACAGCGGAAGAATGG + Intronic
1187308030 X:18114890-18114912 TACTTTGGACAATGGAATGTGGG - Intergenic
1190110747 X:47587503-47587525 CAAGTTGGTCAGAGGAGTGAGGG - Intronic
1190508813 X:51156447-51156469 CAACTTGGGCAGTGGGATATGGG - Intergenic
1196488806 X:116244987-116245009 CAAGGAGGACTGAGGAATGTTGG - Intergenic
1200971101 Y:9153264-9153286 CAAGTTGGACAGTGTTAAGTTGG + Intergenic
1201587672 Y:15579188-15579210 AAAGTTGGAGAATGGAATATGGG - Intergenic
1202139924 Y:21711039-21711061 CAAGTTGGACAGTGTTAAGTTGG - Intergenic