ID: 1063617766

View in Genome Browser
Species Human (GRCh38)
Location 10:7616524-7616546
Sequence CTTTTAATTAAAATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063617757_1063617766 25 Left 1063617757 10:7616476-7616498 CCCACCCTGTCTCTGGAACAATA 0: 1
1: 0
2: 1
3: 29
4: 279
Right 1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG No data
1063617763_1063617766 -1 Left 1063617763 10:7616502-7616524 CCTAAAGGGAAATGAGCAGCCTC 0: 1
1: 0
2: 2
3: 15
4: 229
Right 1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG No data
1063617756_1063617766 26 Left 1063617756 10:7616475-7616497 CCCCACCCTGTCTCTGGAACAAT 0: 1
1: 0
2: 4
3: 66
4: 465
Right 1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG No data
1063617758_1063617766 24 Left 1063617758 10:7616477-7616499 CCACCCTGTCTCTGGAACAATAA 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG No data
1063617760_1063617766 20 Left 1063617760 10:7616481-7616503 CCTGTCTCTGGAACAATAAGACC 0: 1
1: 0
2: 1
3: 12
4: 217
Right 1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG No data
1063617759_1063617766 21 Left 1063617759 10:7616480-7616502 CCCTGTCTCTGGAACAATAAGAC 0: 1
1: 0
2: 2
3: 31
4: 549
Right 1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063617766 Original CRISPR CTTTTAATTAAAATGGAACA TGG Intronic
No off target data available for this crispr