ID: 1063618391

View in Genome Browser
Species Human (GRCh38)
Location 10:7622186-7622208
Sequence GAGCCCCCTGGGAGTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063618391 Original CRISPR GAGCCCCCTGGGAGTCCTGG TGG (reversed) Intronic
900095852 1:939872-939894 CAGCACCTGGGGAGTCCTGGTGG - Intronic
900389112 1:2426468-2426490 GAGTCCCCATGGGGTCCTGGGGG + Intronic
900389786 1:2428922-2428944 GAGCGAGCTGGGAGTCCTGGGGG + Intronic
900412473 1:2519038-2519060 GCACCCCCAGGGAGGCCTGGAGG - Intronic
900433136 1:2612245-2612267 CAGCTCCCTGGGGGTGCTGGGGG + Intronic
900485272 1:2919847-2919869 AAGTCCCCTGGGTGTCCGGGAGG + Intergenic
900518434 1:3094273-3094295 GAGCCACCTGGGAGCTGTGGAGG - Intronic
900518928 1:3096347-3096369 GAGCCTCCTGGGGGTCCTGCGGG - Intronic
900523176 1:3115972-3115994 GGGCCGCCTGGGAGTCCTCCCGG - Intronic
900605295 1:3521127-3521149 GAGGACCCTGGCAGGCCTGGGGG + Intronic
900656308 1:3759949-3759971 GAGCCCCTTGGAGCTCCTGGAGG - Intronic
901129480 1:6953407-6953429 GAGTCCCCTGGTAGCCTTGGTGG + Intronic
901209697 1:7517880-7517902 GATCCCCCCAGGAGGCCTGGAGG + Intronic
901868990 1:12126534-12126556 ATGCCCCCTGGGGGTACTGGAGG - Intronic
902242747 1:15099746-15099768 GGACCCCCTGGTGGTCCTGGGGG + Intronic
902448704 1:16483782-16483804 GAGGAGCCTGGGAGCCCTGGGGG - Intergenic
902468081 1:16630438-16630460 GAGGAGCCTGGGAGCCCTGGGGG - Intergenic
902736309 1:18403607-18403629 GAGCCCCCAGTGTGGCCTGGGGG + Intergenic
902832755 1:19028381-19028403 GAGCCTCCTGGGAGCCCAGACGG + Intergenic
904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG + Intergenic
905269090 1:36774995-36775017 GTGCACCCTGGGACCCCTGGAGG - Intergenic
905846959 1:41241764-41241786 GGGCCCCCGGGCAGTCCTGGCGG + Intronic
905888203 1:41502989-41503011 GAGCAGCCTGGGAGGCCTGCTGG + Intergenic
908414776 1:63902520-63902542 GACCAGCCTGGGAATCCTGGTGG - Intronic
910662915 1:89693008-89693030 AAGCCCCCTGGAAGCCCTAGGGG + Intronic
912571672 1:110628937-110628959 GATTCCCCTGGGAATCATGGTGG + Intronic
912906923 1:113717659-113717681 GAGGCCCCTGAGAATCATGGCGG + Intronic
912953959 1:114139739-114139761 CAGCACCCTGGGCTTCCTGGAGG - Exonic
915489161 1:156241975-156241997 GGGGCCCCTGGGAGTGATGGAGG - Exonic
917509106 1:175655566-175655588 GAGTGCTGTGGGAGTCCTGGTGG + Intronic
917709193 1:177667382-177667404 GAGCCAACTGAGAGTGCTGGAGG + Intergenic
917920366 1:179744733-179744755 GGGCCCCCTGGGCGCCCTGGGGG - Intronic
919924734 1:202186448-202186470 GAGCCCCCTGCCTGGCCTGGAGG + Intergenic
922968712 1:229715989-229716011 GAGGCCGCAGGGAGGCCTGGGGG + Intergenic
923055846 1:230425711-230425733 GCGGCCCCTGGGGGTCCCGGGGG + Intronic
924511347 1:244730998-244731020 GGGGCCCTTTGGAGTCCTGGAGG - Intergenic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1064605722 10:17036589-17036611 CAGCCCCCTGGCAGCCCTGCTGG - Intronic
1065849186 10:29772667-29772689 GAGCCACCTCTGTGTCCTGGAGG - Intergenic
1066477879 10:35765253-35765275 GAGCGCCCTGGGAGGTCCGGGGG - Intergenic
1067146899 10:43700910-43700932 GAGCCCCTTGGGGGTAGTGGGGG - Intergenic
1071088826 10:81895760-81895782 GAGGACCCTGGGGCTCCTGGAGG - Intronic
1071566588 10:86674382-86674404 GAGCCACTTGTGAGTGCTGGGGG - Intronic
1072740469 10:97906115-97906137 GGGCCCCCTGAGAACCCTGGAGG + Intronic
1073860523 10:107732799-107732821 TAGCCCCCAGTGACTCCTGGGGG - Intergenic
1074012091 10:109492508-109492530 CAGCCTCCAGGGAGTCCTGGGGG + Intergenic
1074115029 10:110450099-110450121 CAGCCCCCTGGGAATACAGGAGG - Intergenic
1074377679 10:112952368-112952390 GAGCGCCCTGGGCGCCGTGGCGG + Intronic
1074697569 10:116064442-116064464 GAGCCCACTGCTGGTCCTGGTGG - Exonic
1075718134 10:124568949-124568971 GAGCACGCTGGGAGCCGTGGGGG - Intronic
1076784762 10:132744323-132744345 GGGCCTCCTGGGAGGCCTGTGGG - Intronic
1076806419 10:132861435-132861457 GAGCCTCCTGGGGCTCCTGCTGG + Intronic
1076889097 10:133275308-133275330 GAGCCCTCAGGCAGTGCTGGAGG + Intronic
1077167992 11:1152358-1152380 GGGCTCCCAGGGAGTTCTGGGGG + Intergenic
1077210528 11:1369167-1369189 GAAGCCCCTGGGACTCCTGCAGG - Intergenic
1077229782 11:1453610-1453632 GTGCGGCCTGGGAGTCCTGCCGG - Intronic
1077320445 11:1938593-1938615 GGGCTCCCTGACAGTCCTGGGGG + Exonic
1077323840 11:1954822-1954844 GGGCGCCCTGGGATTCCTGAAGG + Intronic
1079009539 11:16816921-16816943 AAGACCCTTGGGGGTCCTGGGGG + Exonic
1079115253 11:17636485-17636507 GAAGCCCTTGGGTGTCCTGGTGG - Intronic
1079550006 11:21683742-21683764 GAGGCTCATGGGAATCCTGGAGG - Intergenic
1080267937 11:30421155-30421177 GAAGCCCCTGGGTGTCCTGTGGG - Intronic
1081607559 11:44536927-44536949 GAGCATCCTGGGAGCTCTGGTGG + Intergenic
1081672667 11:44950485-44950507 GAGCCCGCTGGGACCCCAGGGGG - Intronic
1082020982 11:47533035-47533057 GAACCCACTAGGATTCCTGGGGG + Intronic
1083226854 11:61290774-61290796 GAGACGCCTGGGAGTGGTGGGGG - Intronic
1083692002 11:64415075-64415097 GAGGCCCCTGGAGGCCCTGGAGG + Intergenic
1083779886 11:64912302-64912324 GAGGCCCCTGGGTGGCATGGGGG - Intronic
1084471028 11:69358966-69358988 GAGGCCCCTGGGGGACATGGGGG - Intronic
1086399659 11:86450101-86450123 GGGCCTCCTGGGAGTCATTGAGG - Intronic
1088742010 11:112774905-112774927 GAGGCCTGTGGGAATCCTGGAGG - Intergenic
1088776182 11:113085620-113085642 GAGTCCCCTGGGGGTTCAGGAGG - Intronic
1088829340 11:113522077-113522099 GACCACCCTAGGAGTCCTGGGGG - Intergenic
1089615734 11:119693684-119693706 GAGCCCCCTGCGTGTTTTGGAGG - Intronic
1089827666 11:121293144-121293166 GCGCCACCTGGGAGTCCGGGCGG + Intronic
1090414907 11:126534233-126534255 TAGCCCCCTTGCAGCCCTGGGGG - Intronic
1090512604 11:127391917-127391939 GCGCGCCATGGGAGTCCTGTTGG + Intergenic
1091327368 11:134701186-134701208 GAGGCCCGTGAGAATCCTGGAGG + Intergenic
1202806826 11_KI270721v1_random:10017-10039 GGGCGCCCTGGGATTCCTGAAGG + Intergenic
1091760485 12:3084160-3084182 GGGCCCCGTAGGGGTCCTGGTGG - Intronic
1091783903 12:3230860-3230882 GAGGCCCCAGGGAGTCCTGCAGG - Intronic
1092152790 12:6262545-6262567 GCTCCCGCTGGGTGTCCTGGGGG - Intergenic
1094491391 12:30963130-30963152 GAGCCGCCTGGGACTGCAGGAGG - Intronic
1095702085 12:45201017-45201039 GGGAGCCCTGGCAGTCCTGGTGG - Intergenic
1096774773 12:53957175-53957197 CTGCCCACTGGGTGTCCTGGGGG - Exonic
1097222576 12:57459816-57459838 GAGGATCCTGGGGGTCCTGGGGG + Intergenic
1098556598 12:71825669-71825691 GAGCCTCGTGGGTTTCCTGGAGG - Intergenic
1102551786 12:113696646-113696668 GAGCACCCTGGTATACCTGGAGG + Intergenic
1102641255 12:114368832-114368854 GAGACCCCTGGGTGTCCTGAGGG - Intronic
1102951713 12:117035644-117035666 GATCCACCTGGAAGTCCCGGGGG + Intergenic
1104017712 12:124971678-124971700 GAAGCCACTGGGACTCCTGGGGG - Intronic
1104767816 12:131341718-131341740 CAGCAGCCTGGGAGTCCTGGAGG + Intergenic
1104811904 12:131624364-131624386 CAGCAGCCTGGGAGTCCTGGAGG - Intergenic
1106028414 13:25976515-25976537 GAGCCCCCAGAGAGACCAGGAGG + Intronic
1112652530 13:101415770-101415792 GAGCCCCCGCGGAGACCTGCTGG + Intronic
1113029039 13:105973862-105973884 AAGCCCCCAGGGAGTGCTTGTGG - Intergenic
1115755462 14:36523197-36523219 GCGCCCCCTCGGATTCCTGGCGG - Intergenic
1117503886 14:56381488-56381510 GATCTCTCTGGGAGTACTGGAGG - Intergenic
1118323692 14:64767851-64767873 GTTCCCCCTGGCAGTGCTGGAGG - Exonic
1119406614 14:74403101-74403123 GAGGCCCCTGGGAGGCATAGGGG - Intergenic
1120716359 14:87845186-87845208 CATCCACCTGGTAGTCCTGGAGG + Intronic
1121096761 14:91222697-91222719 GAGCCAGCTGAGAGCCCTGGAGG - Intronic
1122117222 14:99533826-99533848 GGGCCCCCTGTGAGACCGGGGGG + Intronic
1122198692 14:100108780-100108802 AAGCCCCGTGGGAGTGCAGGAGG - Intronic
1122793197 14:104193113-104193135 CAGCCCCCAGGGAGGCCTTGTGG + Intergenic
1122847707 14:104509916-104509938 GAGCCCTCTGGGAGGCATGCGGG - Intronic
1122969253 14:105145842-105145864 GACCACCCTGTGAGGCCTGGGGG - Exonic
1124138656 15:27057628-27057650 GAGCCCCGAGGGTGACCTGGCGG - Intronic
1125723992 15:41858886-41858908 GAACCTCCTGGGAGTCCTGCAGG + Exonic
1127293737 15:57592078-57592100 GGGCGCCCCGGGCGTCCTGGCGG - Exonic
1127354837 15:58188363-58188385 GGGAGCCCTGGGAGTCCTGAAGG + Intronic
1128735016 15:70048586-70048608 AAGGCCGCTGTGAGTCCTGGTGG - Exonic
1131470241 15:92690231-92690253 GAGGCCTCAGTGAGTCCTGGAGG - Intronic
1132549707 16:549294-549316 GAGCGCCCTGGCGGTGCTGGCGG + Exonic
1132767736 16:1542995-1543017 GAGCCCCCTGGGGTCGCTGGGGG - Intronic
1132877047 16:2144593-2144615 GAGCGCCCTGGGTCTCCTTGGGG - Intronic
1132950245 16:2557787-2557809 ACGCCCCCTGGCATTCCTGGTGG + Exonic
1132964101 16:2642383-2642405 ACGCCCCCTGGCATTCCTGGTGG - Intergenic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1133023434 16:2976901-2976923 GAGCCCCCTGGGCCTCTTGAGGG + Exonic
1134121182 16:11586301-11586323 GAGGCCCCTGGGAGACCCTGGGG - Intronic
1134222845 16:12368814-12368836 GAGCCCCAGGAGAATCCTGGTGG - Intronic
1135967990 16:27051654-27051676 GAGCTCCCTTGAATTCCTGGAGG - Intergenic
1138360896 16:56425881-56425903 GCGGCCCCTAGGAGTGCTGGGGG - Intergenic
1139647236 16:68340254-68340276 GAGCCCCCTGGGATTACTCAGGG - Intronic
1140040436 16:71403896-71403918 GGCGGCCCTGGGAGTCCTGGAGG + Intergenic
1142030237 16:87834910-87834932 CAGGCCCCTGTGCGTCCTGGCGG - Intronic
1142139497 16:88466488-88466510 GAGCCCCCTGGGAGGCTCGTGGG - Intronic
1142148803 16:88503740-88503762 CAGCCCCATGTGAGTCCCGGAGG - Intronic
1142172671 16:88630979-88631001 GAGCCCCTTGCCTGTCCTGGTGG + Intronic
1142234400 16:88915057-88915079 TGGCACCCTGGGAGTCCTGGGGG + Intronic
1142249140 16:88983181-88983203 GAGCCCCAGGGGAGTCCTGAGGG - Intergenic
1142631495 17:1229186-1229208 GAGCCGCCTGGGGGTCCCCGAGG + Intergenic
1143386207 17:6532186-6532208 GAGCCACCTGCGAATCCAGGGGG - Intronic
1143839337 17:9719380-9719402 GAGACCCCTGAGAGGCCTGGGGG + Intronic
1143995548 17:11003495-11003517 TGGCCCCATGGGAGTCCTGCTGG + Intergenic
1144515857 17:15917389-15917411 GCGCCCCTTGGGAGCCCTGAGGG - Intergenic
1146915059 17:36673103-36673125 GAGACCCCAGGGTGGCCTGGAGG + Intergenic
1146945215 17:36869081-36869103 GGGCCCCCTGGGCCTCATGGGGG + Intergenic
1146955532 17:36934720-36934742 GAGGCGCCTGGGGGTCCGGGTGG + Intergenic
1147292606 17:39456076-39456098 GAGCATCTTGGGAGTCCAGGTGG + Intergenic
1147464252 17:40598546-40598568 GGGCCCTCTGGGAATCCTGTCGG - Intergenic
1147667930 17:42160332-42160354 GAGCCTGCTGGGTGGCCTGGGGG + Exonic
1148332500 17:46820761-46820783 AAGCCACCTGGGAGCCCTGTGGG - Intronic
1148848762 17:50544055-50544077 GCTCCCCTTGGGAGTCCTCGGGG - Intronic
1148961627 17:51398021-51398043 GTGTCCCCTGGGGGTCCAGGGGG + Intergenic
1149996023 17:61406320-61406342 GAGACCTCTGGGAGGGCTGGTGG - Intronic
1150536712 17:66050362-66050384 CAGATCCCTGGGAGTCCTTGAGG - Intronic
1151485277 17:74395077-74395099 GCGCCCACTGGGAGTGCAGGAGG + Intergenic
1151557542 17:74854284-74854306 GGGAACCCTGGGAGCCCTGGGGG - Intronic
1151826061 17:76525103-76525125 CTGCCCCTTGGGAGTCCTGCGGG - Intergenic
1152070212 17:78130594-78130616 GAGCTCCCTGGGAGGCCAAGTGG + Intronic
1152235660 17:79137023-79137045 TGGACCTCTGGGAGTCCTGGGGG - Intronic
1152314537 17:79572506-79572528 GATCCACCAGGGAGGCCTGGTGG - Intergenic
1152327133 17:79648023-79648045 GAGCCTCCTGGGGGTCCAGCAGG + Intergenic
1152780924 17:82227155-82227177 GTGCTCCCTGGGACCCCTGGAGG + Intergenic
1153805347 18:8705473-8705495 GAGCCCCGCGGGAATCCTCGGGG + Intergenic
1157221307 18:45829956-45829978 GAGTCCCGTGGTAGTCGTGGTGG - Intronic
1159889876 18:73943391-73943413 GACCCTCATGGGTGTCCTGGGGG + Intergenic
1160071774 18:75635323-75635345 CAGCCCCCAGGTACTCCTGGTGG + Intergenic
1160514510 18:79470983-79471005 TAGCCCTCGGGGAGTCCTGCCGG + Intronic
1160537494 18:79602932-79602954 AAGCCCCCTGACAGTCCTGCTGG - Intergenic
1160701838 19:511279-511301 GAGCCGCCCGGGAGCCCAGGAGG + Intronic
1160840316 19:1143829-1143851 GAGCTTCCTGGGTGACCTGGAGG - Intronic
1160970792 19:1766953-1766975 GTGGCCCCTGGGAGTCCCAGAGG + Intronic
1161040738 19:2109630-2109652 CAGGCCCCTGGAAGTCCTGAAGG - Intronic
1161408415 19:4102977-4102999 GAGCCCCCTGGGGGTCTGGACGG - Intronic
1161562583 19:4981622-4981644 GGGCCCCTTGGGAGTGCAGGTGG + Intronic
1162327849 19:10009419-10009441 GAGCCCCCAAGGGGTCCCGGGGG - Intronic
1162451788 19:10759472-10759494 GGGCCCCCTGGGAGTACGGGGGG + Intronic
1162457032 19:10791609-10791631 CAGCCTCCTGGGGGCCCTGGAGG - Intronic
1164883636 19:31758980-31759002 GAACCCCCTGGGAGATTTGGGGG - Intergenic
1164883865 19:31760451-31760473 GACCCCCCTGGGAGATTTGGGGG - Intergenic
1165436241 19:35797036-35797058 GAGCTGGCTGGGGGTCCTGGGGG + Intergenic
1166641689 19:44499582-44499604 GGGCCCCCTGCACGTCCTGGGGG - Intronic
1166945298 19:46392378-46392400 GAGCCCCCACGGAGTCCAGCCGG - Intronic
1167320758 19:48796094-48796116 GAGGCCCCTGGGTGCCCTGGTGG - Intronic
1168239190 19:55080783-55080805 GAGCCCCCTGGATGTCCTCTCGG - Exonic
1168721505 19:58557270-58557292 GAGGCGCCTGGGGGTCCAGGAGG - Intronic
924968554 2:101195-101217 GAGGCCCCTGGCAGGCCCGGGGG + Intergenic
925182756 2:1827528-1827550 GAGCGCCAGGAGAGTCCTGGAGG + Intronic
927175716 2:20405822-20405844 GAGTCCAGTGGGATTCCTGGGGG - Intergenic
927519412 2:23690006-23690028 GAGGCCCCTTGGGGTCCTGGTGG + Intronic
928050058 2:27983122-27983144 GAACCCCTTGGAAGTGCTGGTGG - Intronic
928198561 2:29232127-29232149 CAGCACCCTGGGAGCCCTGCAGG - Intronic
928413942 2:31075676-31075698 CAGCAGCCTGGCAGTCCTGGTGG - Intronic
929947553 2:46382111-46382133 GGGCCTCCTGGGGGTTCTGGTGG + Intronic
930013470 2:46955487-46955509 GAGCTCCCTGGTAGTCAAGGAGG + Intronic
930503749 2:52255962-52255984 GAGCCCCATTGCAGGCCTGGAGG - Intergenic
932599112 2:73112121-73112143 GTGGTCCCTGGGAGGCCTGGGGG - Intronic
932751151 2:74372488-74372510 CAGCCCACTGGGAGACCTTGGGG - Intronic
934516798 2:94993526-94993548 GAGGCCACAAGGAGTCCTGGTGG + Intergenic
934560990 2:95313231-95313253 GCCCAGCCTGGGAGTCCTGGAGG + Intronic
934777522 2:96948883-96948905 GAGCCCAGTGGGACTCCTGGGGG + Intronic
935108892 2:100073472-100073494 GTGTCACCTGGCAGTCCTGGGGG - Intronic
937059572 2:118971244-118971266 TAGATCCCTGGGAGTCTTGGAGG - Intronic
937340720 2:121088856-121088878 GAGCCCCTTGGGAGTTCCTGGGG - Intergenic
937931152 2:127205944-127205966 GAGCCAACATGGAGTCCTGGCGG - Intronic
937989044 2:127652155-127652177 GAGGGACCTGGGAGTCCTGGTGG + Exonic
938162403 2:128997576-128997598 AAGGCTCCTGGGGGTCCTGGGGG - Intergenic
938289069 2:130140039-130140061 GAGGCCCCAGGCAGTCCCGGAGG - Exonic
942112470 2:172695748-172695770 GAGCCCCCTGTCATTCCTAGAGG - Intergenic
942450807 2:176107058-176107080 GAGCGCCCGGGGAGAGCTGGCGG + Intronic
948754155 2:240149520-240149542 GAGCCCCCTGGGCGTTCTTATGG - Intergenic
948913713 2:241019469-241019491 GACCCCACTGGTGGTCCTGGGGG + Intronic
1171223405 20:23421103-23421125 AGGGCCCCTGGGCGTCCTGGGGG + Intronic
1171227425 20:23453127-23453149 AGGGCCCCTGGGAGTCCTGGAGG + Intergenic
1172594688 20:36142676-36142698 GAGGCCCCTGGGTGGCCTGATGG + Intronic
1174842607 20:53914407-53914429 GAGCACACTGGGATGCCTGGTGG + Intergenic
1175571729 20:60028162-60028184 GAGCAGCCTGGAGGTCCTGGGGG - Intronic
1175915565 20:62424217-62424239 GAGCCCCCTGGAAGGAGTGGGGG + Intronic
1175972842 20:62695636-62695658 GAGCCTCCTGGGGGCCCTGGAGG - Intergenic
1176056227 20:63150666-63150688 GATCCCACTGGGAGACCTGGTGG - Intergenic
1176077102 20:63253679-63253701 AAGCTCCCTGGGACGCCTGGGGG - Intronic
1176375862 21:6086643-6086665 GAGCCCCAAGGGAGGCTTGGCGG - Intergenic
1176952398 21:15064101-15064123 GAGCCCGGTGGAAGTCCGGGAGG - Intronic
1179243040 21:39608837-39608859 CAGCCCCCTGGGAGGGGTGGTGG + Intronic
1179747612 21:43451601-43451623 GAGCCCCAAGGGAGGCTTGGCGG + Intergenic
1179930445 21:44567979-44568001 GCGCCCCCTGGACATCCTGGCGG - Exonic
1180014179 21:45072255-45072277 GAGCCGCCTGAGAGGCCTGTGGG + Intergenic
1180231318 21:46428385-46428407 GTGCCCCCAGGGAGACCTGCAGG + Exonic
1181568279 22:23752553-23752575 GAGCCCCCAGGGGGCCATGGTGG + Intergenic
1183300811 22:37058246-37058268 GAGCCCCCAGGATGGCCTGGAGG + Intronic
1183333234 22:37232467-37232489 GTGAGCCCTGGGAGTGCTGGGGG - Intronic
1183629178 22:39022765-39022787 GAGCCCTCCTGGAGTCCTCGGGG - Intronic
1184432255 22:44448397-44448419 GGGCTCCCTGGGAGTCCGGACGG - Intergenic
1184450495 22:44579684-44579706 GAGCCTCCAGGGCTTCCTGGAGG - Intergenic
1184657258 22:45948133-45948155 GAGCCCCCGGGGAGTTGTGGTGG - Intronic
1184688063 22:46105254-46105276 GAGCCCTGTGGGAGCCCTGTGGG + Intronic
1185056038 22:48578816-48578838 GAGCCCCAGGGGAGGCCTGGGGG + Intronic
1185057713 22:48589554-48589576 GAGCACCCTGGGTTTCCAGGTGG - Intronic
1185075494 22:48680006-48680028 GAGGCCTCTGTGACTCCTGGGGG - Intronic
950526001 3:13523645-13523667 GAGAGCCTTGGGATTCCTGGGGG - Intergenic
952830373 3:37559771-37559793 TGGCTCCCTGGGAGGCCTGGTGG + Intronic
952945069 3:38473544-38473566 GAGGCCCCTGGGTCTCCAGGTGG + Intronic
953004541 3:38965888-38965910 GAGACTCATGGGAGCCCTGGAGG + Intergenic
953314167 3:41910348-41910370 CAGCACTCTGGGAGGCCTGGTGG + Intronic
954400686 3:50318002-50318024 GAGCCCCCAGGAAGCCCAGGAGG - Exonic
958265342 3:91431647-91431669 GAGGCCCCAAGGAGTCCAGGAGG + Intergenic
960121071 3:113948598-113948620 GAGCCCCCTGTGTGGCCAGGCGG + Intronic
960948154 3:122981160-122981182 CAGTCCCCTGGGATTCGTGGAGG - Intronic
961793214 3:129391512-129391534 CAGCTCCCTGAGGGTCCTGGTGG + Intergenic
961823232 3:129585938-129585960 GAGTACCCAGTGAGTCCTGGGGG - Exonic
962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG + Intronic
967257917 3:187612064-187612086 CAGACCCCTGGGAGTCCATGAGG - Intergenic
968370265 3:198219539-198219561 GAGGCCCCTGGGAGGCAAGGCGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968659727 4:1793990-1794012 GCGCCTCCTCGGAGTCCTTGGGG + Exonic
968761032 4:2442877-2442899 GAGCTCACTGGGGGTGCTGGGGG + Intronic
968916651 4:3499688-3499710 GGGGCACCTGGGTGTCCTGGAGG + Intronic
968960306 4:3739959-3739981 GAGGCCCATGGGAGTCCCAGGGG - Intergenic
969351485 4:6600491-6600513 GGCTCCCCTGGGAGTTCTGGAGG + Intronic
973723648 4:53750723-53750745 GAAGCCCCTGGGAGTAGTGGGGG + Intronic
973789516 4:54365236-54365258 GAGACACCTGGGAGTCCCAGAGG - Intergenic
980106188 4:128590936-128590958 GAGCCCTCAGAGAGTCCAGGAGG - Intergenic
983649621 4:170025910-170025932 GAGCCTCCTAGGTGTCGTGGGGG - Intronic
985542778 5:494488-494510 GAGGCCTTTGGGAGTCCTGCTGG + Intronic
986050248 5:4083640-4083662 GAGCCCGCTGGGAGCCCTCCTGG - Intergenic
987031873 5:13983669-13983691 GAGCCCCCCAGGCTTCCTGGAGG + Intergenic
988989435 5:36655088-36655110 GTGCCTCCTGGGGGACCTGGAGG + Intronic
992611563 5:78512577-78512599 GGGCCTCCTGGGAGTCCTTGTGG - Intronic
993502766 5:88680759-88680781 GAGACCCCTGGGAGGACTGTAGG + Intergenic
996884276 5:128337725-128337747 GAGCCCTGTGGAAGTCCTTGTGG - Intronic
997303830 5:132824622-132824644 GGGGCCCCTGGGAGGCATGGGGG + Exonic
997364785 5:133318927-133318949 GAGCGCCCTGGGAGTTCTTGGGG + Intronic
997675047 5:135706696-135706718 GAGCCCCCTGGGAGGACGAGAGG + Intergenic
998060364 5:139114247-139114269 CAGCCCCCTGGGAGAGCAGGTGG - Intronic
998173352 5:139885353-139885375 GAGGCCGCTGAGAGGCCTGGAGG + Intronic
998526138 5:142844976-142844998 GAGCCCTCTGTGAGGACTGGAGG + Intronic
1000351281 5:160354851-160354873 GAGGGCCCTGGGGCTCCTGGGGG + Exonic
1001164835 5:169354936-169354958 GAGCCCGTGGGCAGTCCTGGGGG + Intergenic
1001933152 5:175687231-175687253 GATCGCCCTGGCAGTCTTGGTGG - Intergenic
1003616211 6:7657466-7657488 GAGGCCCTTTGGAATCCTGGAGG - Intergenic
1005674700 6:28141822-28141844 AAGCTCTCTAGGAGTCCTGGAGG - Intergenic
1006093540 6:31642202-31642224 GAGCCCCCAGGGAGCCCAGCAGG + Exonic
1006838586 6:37014110-37014132 CAGCCCCCTGGGACCCCTGGGGG - Intronic
1008374311 6:50773839-50773861 GAGGCCCCTGGAAGTGCTGGTGG + Intergenic
1008990031 6:57591010-57591032 GAGGCCCCAAGGAGTCCAGGAGG - Intronic
1009178610 6:60489550-60489572 GAGGCCCCAAGGAGTCCAGGAGG - Intergenic
1013119128 6:107125907-107125929 GAGGCCCCTGGAAGTCCCTGGGG - Intergenic
1015966212 6:138697156-138697178 AAGCTCCCTGCGAGGCCTGGAGG + Intergenic
1016991105 6:149929166-149929188 GAGAACCCTGGGGGTGCTGGAGG - Intergenic
1017416132 6:154222874-154222896 GACCTCCCTGCCAGTCCTGGAGG + Intronic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1017815024 6:158010383-158010405 CAGGCCTCTGGGAGTGCTGGAGG + Intronic
1018067904 6:160136475-160136497 GAGCCACCTGGGAGCCCCTGGGG - Intronic
1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG + Intergenic
1019428437 7:987938-987960 GGGTCCCCTGTGTGTCCTGGGGG + Intronic
1019496821 7:1344657-1344679 GAGCTCCTGGGGAGTCTTGGGGG - Intergenic
1020139223 7:5603643-5603665 GAGCCGTCCTGGAGTCCTGGAGG + Intronic
1022114225 7:27248493-27248515 GTGCCTTCTGGGAGTCCAGGAGG + Intergenic
1022241383 7:28515955-28515977 GAGCTCTCTGGGAGGCCTCGGGG + Intronic
1022412939 7:30153470-30153492 GAGTCTCCTGGGTGGCCTGGTGG + Intronic
1023622365 7:42086697-42086719 GAGCCCCCTGGGAAGCCTGATGG - Intronic
1023871690 7:44266715-44266737 GTGCCCCGCGGGGGTCCTGGGGG - Intronic
1024883697 7:54117223-54117245 TAGTTCCCTTGGAGTCCTGGTGG - Intergenic
1025992307 7:66505320-66505342 GCGCCGCCTGGGCGTCCTGCTGG + Intergenic
1026458314 7:70591913-70591935 GAGCCTCCTGGGAAGCCTAGAGG - Intronic
1029279016 7:99424920-99424942 GAGCAAGCTGGGAGACCTGGAGG - Exonic
1029480147 7:100807352-100807374 GAGCTCCCTGGTAATGCTGGGGG - Exonic
1029611023 7:101626668-101626690 GGGCCCCCTGGGAGGGCCGGGGG - Intronic
1029706517 7:102279477-102279499 GTGGCCCCTGGGAGGCCTGGGGG - Intronic
1029710232 7:102295287-102295309 GAGCCCCCTGGGGGTCCTAATGG + Intronic
1032011764 7:128351891-128351913 TCGCCCCTCGGGAGTCCTGGCGG - Exonic
1032311067 7:130787568-130787590 CAGGCCCCTGGGAATGCTGGTGG + Intergenic
1032469741 7:132169703-132169725 GGGCACCCCGGGACTCCTGGGGG + Intronic
1034529980 7:151689619-151689641 TGGCCTCCTGGGAGACCTGGCGG - Intronic
1034762587 7:153686969-153686991 GAGCTCCCTGAGAGTTATGGTGG - Intergenic
1035224326 7:157425192-157425214 GAGCCCCCTGTGAGCCCAGAGGG + Intergenic
1035311769 7:157974309-157974331 GAGCCCCGTGGAAGACCTTGTGG - Intronic
1036045335 8:5133770-5133792 ACGCTCCCTGGGAGACCTGGAGG + Intergenic
1036558801 8:9884183-9884205 AAGGCCCCTGGGAACCCTGGAGG + Intergenic
1037743837 8:21628018-21628040 GAGTCCTCTGCAAGTCCTGGTGG - Intergenic
1039911863 8:41832684-41832706 GAACCCTCTGGGAACCCTGGGGG - Intronic
1043516730 8:81001560-81001582 GAGCCTCTTGGGGGCCCTGGAGG - Intronic
1044525184 8:93242859-93242881 GGGCCCCAAGGCAGTCCTGGTGG - Intergenic
1047765417 8:127986269-127986291 GAACCTCCTGGGAGCCTTGGAGG + Intergenic
1049145667 8:141000300-141000322 GAGCCCCGTGGGCTTCTTGGCGG - Intronic
1049219532 8:141422560-141422582 GGGTCCCCTGGGAGGCCTGCAGG + Intronic
1049478121 8:142806296-142806318 GAGCCTTCTGAGAGTCCTGGAGG - Intergenic
1049704619 8:144035481-144035503 GCGCCTCCTGGGAGTCCCCGTGG + Intronic
1049762938 8:144339030-144339052 CAGCCCCCCGGGACCCCTGGCGG + Intergenic
1053123501 9:35562350-35562372 GAGCCCCCGGGGAGGCTTTGGGG - Intronic
1053728402 9:41027296-41027318 GATCTCTCTGTGAGTCCTGGTGG + Intergenic
1054700103 9:68404784-68404806 GATCTCTCTGTGAGTCCTGGTGG - Intronic
1055403879 9:75953890-75953912 GAGCCCCATTGAAGTCCTGTGGG + Intronic
1057075364 9:92135650-92135672 GAGCCCCCTGCCTGGCCTGGGGG + Intergenic
1057081224 9:92176088-92176110 GAGGCCTCTAGGAGTCCTGCTGG + Intergenic
1057274359 9:93668486-93668508 GAGAGGCCTGGGGGTCCTGGGGG + Intronic
1060940428 9:127540248-127540270 GAGGCCCCAGGGTGGCCTGGAGG + Intronic
1061099165 9:128479035-128479057 GTGCCCCAGGGGAGGCCTGGAGG + Intronic
1062101896 9:134732868-134732890 GAGACCCCAGGGAGAACTGGAGG - Intronic
1062524025 9:136971021-136971043 GAACCCCCTTGGAGGCCGGGAGG + Exonic
1203512492 Un_KI270741v1:134485-134507 GCGCCCACTGGAAGCCCTGGCGG - Intergenic
1187648534 X:21375100-21375122 CAGGCCCCTGCCAGTCCTGGAGG - Intronic
1192223455 X:69212747-69212769 GAGCTCCCTGGAGGGCCTGGTGG - Intergenic
1195167922 X:102238733-102238755 GAGTCTGCTGGGTGTCCTGGGGG - Intergenic
1195190935 X:102448354-102448376 GAGTCTGCTGGGTGTCCTGGGGG + Intronic
1195940830 X:110166570-110166592 GGGGCCCCTGGGAGGCCTGTGGG + Intronic
1199787237 X:151116412-151116434 GAGCCAGCTGTAAGTCCTGGTGG - Intergenic
1199849523 X:151715513-151715535 GAGGCCCCTGGGGGTTCTAGTGG + Intergenic
1200079151 X:153566965-153566987 GAGGCCCCTTGGACCCCTGGGGG - Intronic