ID: 1063624806

View in Genome Browser
Species Human (GRCh38)
Location 10:7679009-7679031
Sequence GTGTGTGCGCGCGCGCGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063624806_1063624809 25 Left 1063624806 10:7679009-7679031 CCTCCGCGCGCGCGCGCACACAC No data
Right 1063624809 10:7679057-7679079 CACACGCAGGAGAGCACCAGAGG No data
1063624806_1063624808 12 Left 1063624806 10:7679009-7679031 CCTCCGCGCGCGCGCGCACACAC No data
Right 1063624808 10:7679044-7679066 ACACACACACACACACACGCAGG 0: 77
1: 2076
2: 3521
3: 4671
4: 9122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063624806 Original CRISPR GTGTGTGCGCGCGCGCGCGG AGG (reversed) Intergenic
No off target data available for this crispr