ID: 1063627534

View in Genome Browser
Species Human (GRCh38)
Location 10:7704536-7704558
Sequence CCAGTGATTAGGTGGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063627534_1063627540 9 Left 1063627534 10:7704536-7704558 CCAGACACCCACCTAATCACTGG 0: 1
1: 0
2: 0
3: 5
4: 136
Right 1063627540 10:7704568-7704590 ATCTCTGTCTTACCACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063627534 Original CRISPR CCAGTGATTAGGTGGGTGTC TGG (reversed) Intronic
901265359 1:7905981-7906003 CCAGTGGGTGGGTGGGGGTCGGG + Intergenic
907027250 1:51132740-51132762 CCAATGATTATGTGTGTCTCGGG - Intronic
910798643 1:91123349-91123371 CCTTTGATTACTTGGGTGTCTGG + Intergenic
910799037 1:91127578-91127600 CCAGTGTCTAGGATGGTGTCTGG + Intergenic
910919923 1:92333728-92333750 TCACTGATTAGGTGGGAGTAAGG - Intronic
915164727 1:153942175-153942197 CTGGTGATAAGGTGGGTGTGTGG - Exonic
917251108 1:173061831-173061853 CCAGGCCTTAGGTGGGTTTCAGG - Intergenic
918059832 1:181051471-181051493 CCGATGATAAGGTGGGGGTCAGG + Intronic
918321442 1:183368979-183369001 CCCGTGATTAGGCAGCTGTCAGG - Intronic
919118923 1:193314885-193314907 CCAGGGATTGGTTGGGTGGCAGG + Intergenic
923031692 1:230254184-230254206 CCACTGACTAGGTGAGTGACTGG - Intronic
923072510 1:230578412-230578434 CCAGAGCTTGGGTGGGTTTCAGG - Intergenic
1063627534 10:7704536-7704558 CCAGTGATTAGGTGGGTGTCTGG - Intronic
1069045787 10:63741787-63741809 CCAGTGATGGGGTAGGGGTCGGG - Intergenic
1070958968 10:80485721-80485743 CCCGAGGTTAGGTGGGTGGCAGG + Intronic
1076085118 10:127620540-127620562 ACAGTGATTAGTTGGGAGTCAGG + Intergenic
1077076733 11:705640-705662 TCGGTGAGTGGGTGGGTGTCAGG - Intronic
1078899869 11:15631761-15631783 CCATGTATTAGGTGGGTGTTTGG + Intergenic
1083492125 11:63020946-63020968 CCAGTTCTTAGGCAGGTGTCTGG - Intergenic
1084172381 11:67406736-67406758 CCGGTGAGTGGGTGGGGGTCTGG + Intronic
1085528568 11:77178257-77178279 TGAGTGACTAGGTGGGTGTGTGG - Intronic
1089166431 11:116480936-116480958 CCAGTGCTTAGATCAGTGTCTGG - Intergenic
1091195495 11:133727474-133727496 CCAGTGAATGGGTGGCTGGCTGG - Intergenic
1091546667 12:1505621-1505643 CCTGTGCTTAGGAGAGTGTCTGG + Intergenic
1092236870 12:6815925-6815947 GAAGTGACAAGGTGGGTGTCTGG + Intronic
1093383344 12:18521481-18521503 CCAGTGAGTAGGAGTGGGTCAGG + Intronic
1097250624 12:57630720-57630742 CCATTGGTTAGGTGGTGGTCAGG - Intronic
1100815516 12:98383533-98383555 CCTGTGAGTAGGGGGGTGTGGGG + Intergenic
1100843634 12:98638167-98638189 ATACTGATTAGGTGGGTGACTGG + Intronic
1106477358 13:30110127-30110149 CCAGTGTTTTTGTGGGTTTCTGG - Intergenic
1108937171 13:55896935-55896957 CCAGAGAATAGGTTGGTGTAAGG - Intergenic
1112128635 13:96497410-96497432 TCATTGATTAGATGGGTCTCAGG - Intronic
1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG + Intergenic
1114653810 14:24303880-24303902 CCAGTGACTAATTGGGAGTCAGG + Intronic
1118506115 14:66413766-66413788 AGAGTGATTGGGTGGGTGTTGGG - Intergenic
1123021751 14:105401168-105401190 CCAGTGCTTAGGACAGTGTCTGG + Intronic
1125202015 15:37108346-37108368 CCAGAGATGGGGTGGGTGTAGGG - Intergenic
1127607088 15:60597356-60597378 CCACAGAATAGGTGGGTGGCAGG + Intronic
1131233868 15:90679991-90680013 CAAGTGATGTGGTGGTTGTCAGG - Intergenic
1131789734 15:95951181-95951203 CCAATAGTTAGTTGGGTGTCGGG - Intergenic
1133461190 16:5987841-5987863 AAAGTGCTTAGCTGGGTGTCAGG - Intergenic
1135198349 16:20413835-20413857 CCAGTCTTTGGGTGGGTGTTGGG - Intronic
1135219880 16:20604723-20604745 CCAGTCTTTGGGTGGGTGTTGGG + Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139733469 16:68967698-68967720 CAAGTGAGTAGGTGGTTTTCCGG + Intronic
1139953968 16:70684761-70684783 CCAGTGATAGGGTGGGGGCCAGG - Intronic
1140779592 16:78282523-78282545 CCACTGATTTGATGGGGGTCAGG + Intronic
1141280052 16:82623263-82623285 CCAGTGATTAGGCGTGTCTGGGG - Intergenic
1143893817 17:10121580-10121602 CCAGTGCTTAGGCCAGTGTCTGG + Intronic
1147967515 17:44200792-44200814 CCAGTGACAAGGAGGCTGTCTGG - Intergenic
1148565994 17:48633422-48633444 CCTGTGAGCAGGCGGGTGTCTGG - Intronic
1150735881 17:67738779-67738801 CCAATGATTAGGAGAGTGTTTGG + Intronic
1155080449 18:22405167-22405189 CCAGTGTTTAGGAGGGGTTCAGG - Intergenic
1156015119 18:32538616-32538638 CCAGTGCTTAGTAGAGTGTCTGG + Intergenic
1159462882 18:68742623-68742645 GCATAGATTGGGTGGGTGTCTGG + Intronic
1166267921 19:41696439-41696461 CCAGAGAGGAGGTGTGTGTCAGG - Intronic
1166665961 19:44680613-44680635 CCAGTGAGGAGCTGGGTGTGGGG - Intronic
925490057 2:4381383-4381405 CATTTGATTAGGTGGGTGCCTGG - Intergenic
925924640 2:8661274-8661296 TCAGTGAATAGGTGGATGTGAGG + Intergenic
925998778 2:9313511-9313533 CCAGTGATAAGGTGGGTTGTGGG - Intronic
926186939 2:10697962-10697984 CCAGTGATTAGGAGAGGCTCTGG + Intergenic
929892448 2:45929532-45929554 GCAGTGTCTAGGTGGGTGGCTGG + Intronic
930629638 2:53738141-53738163 CCATTGATTAGGTGATTATCAGG - Intronic
932689746 2:73902183-73902205 CCAGTGAGTATGAAGGTGTCAGG - Intronic
933159023 2:79003962-79003984 CCAGTGAGTAGGTGAGTCTGTGG - Intergenic
937753414 2:125505818-125505840 CCAGTCATGAGGTGGGGGTAGGG - Intergenic
939429839 2:142089072-142089094 CCAGTGCCTAGAAGGGTGTCTGG - Intronic
940500930 2:154493018-154493040 CCAGTAATAAGGTGGGTGGCAGG + Intergenic
942333057 2:174849699-174849721 AAAGTGCTTAGTTGGGTGTCTGG - Intronic
943007820 2:182408098-182408120 CCAGTGATTAGCTATGTGTGGGG - Intronic
944366888 2:198931287-198931309 CCAGTGACTAGTGAGGTGTCTGG + Intergenic
945145927 2:206737977-206737999 CCAGTGAGTAAGTTGGTGTCTGG - Exonic
946292513 2:218755883-218755905 CCACAGAGTAGGTGGGTGTTTGG + Intergenic
946826794 2:223687562-223687584 TCAGTGAGTAGGTGGCTGACTGG - Intergenic
947158618 2:227189096-227189118 CCAGAGAGAAGGTGAGTGTCTGG + Intronic
948354409 2:237366523-237366545 GTAGTGGTGAGGTGGGTGTCAGG + Intronic
1169084485 20:2818332-2818354 CCAGGGCTTGGGTGGGGGTCAGG - Intronic
1172357177 20:34288266-34288288 GCTGTGACTGGGTGGGTGTCAGG + Intronic
1174574996 20:51531063-51531085 CCAGTGGGTAGGTGGCTGTGAGG - Intronic
1175469927 20:59220352-59220374 CCAGGCAGCAGGTGGGTGTCGGG - Intronic
1175526585 20:59638683-59638705 CCAGTGGATAGGTGGGTGGAGGG + Intronic
1175526657 20:59638995-59639017 CCAGTGGATAGGTGGGTGGGTGG + Intronic
1176048719 20:63105560-63105582 CCAGTGCAGAGGAGGGTGTCAGG - Intergenic
1181162670 22:20967293-20967315 CCTGCGAGGAGGTGGGTGTCCGG + Intronic
1181857176 22:25790365-25790387 TTAGTGATAAGGTGGGCGTCTGG + Intronic
1183573156 22:38669424-38669446 CCAGTGCTTAGGAGAGTGCCTGG - Intronic
1183614910 22:38938161-38938183 TCAGTGATGAACTGGGTGTCAGG + Intergenic
1183685029 22:39356777-39356799 CCAGTGATTGGCTGTGTGACTGG + Intronic
1183819568 22:40334492-40334514 ACAGGGATGAGGTGGGTGGCGGG - Exonic
949384786 3:3489312-3489334 TCAGGGATTAGCTGGGTGCCTGG + Intergenic
954711772 3:52508421-52508443 CCAGTGACTGGCTGTGTGTCTGG + Intronic
954802394 3:53194709-53194731 CCAGCCATTGGGTGGGTGCCAGG + Intergenic
956298081 3:67736651-67736673 CCAATGAATAGGTGGGTGGATGG - Intergenic
959260359 3:104071688-104071710 CCAGGGATTCTGTGGGTGTGTGG + Intergenic
961110885 3:124282138-124282160 CCAGTGACTGGCTGGATGTCAGG + Intronic
963572046 3:147009531-147009553 TGAGTGATTAGATGAGTGTCTGG - Intergenic
970589648 4:17548071-17548093 CCAGGGATGAGGTGGATCTCAGG + Intergenic
971264866 4:25088526-25088548 CCAGTCATTAACTGGCTGTCAGG + Intergenic
974250265 4:59376149-59376171 CCAGTGATGAGATGGGAGACTGG - Intergenic
975268240 4:72396823-72396845 TCAGAGATTAGGTAGGAGTCAGG + Intronic
978254367 4:106675849-106675871 CCTGTGGTTAGGTGGGGGTCTGG + Intergenic
983182245 4:164662238-164662260 CCAGTGATCAGCTATGTGTCAGG - Intergenic
986659301 5:10044805-10044827 ACAGTCATTGGGTGGCTGTCAGG + Intergenic
987203213 5:15598537-15598559 CCAGTGGTAGGGTGGGTGTTGGG + Intronic
991272799 5:64805319-64805341 ACAGTGATTACTTGAGTGTCAGG - Intronic
992471557 5:77061211-77061233 ACAGTGATTAGGTGGGGCACAGG - Intronic
997657827 5:135568473-135568495 CCAGTGCTTGGGTGAGTGCCCGG + Intergenic
1001535938 5:172497870-172497892 CCAGAGATGAGGGGGGTGACAGG - Intergenic
1001632010 5:173182453-173182475 CCAGAGATTTGATGGGTTTCAGG - Intergenic
1001982878 5:176048300-176048322 CCAGGCCTCAGGTGGGTGTCAGG - Intergenic
1002234585 5:177795757-177795779 CCAGGCCTCAGGTGGGTGTCAGG + Intergenic
1005916800 6:30359504-30359526 TCAGAGATTAGGTGGGAGTGAGG - Intergenic
1006721339 6:36153782-36153804 CCAGGGGATAGGTGGGTGTTAGG - Intergenic
1012219545 6:96631865-96631887 ATAGTGATTAGGTGGTTTTCTGG - Intergenic
1014221632 6:118804278-118804300 CCAATGATTAGTGGTGTGTCTGG - Intergenic
1015409979 6:132883251-132883273 CCAGTGAGTAGCTTGGTATCAGG - Intergenic
1020813258 7:12872358-12872380 CCAGAGATGAGGTGGTTCTCAGG - Intergenic
1024218040 7:47264459-47264481 CAAATGATTAGGTGGGGCTCAGG - Intergenic
1024510198 7:50197750-50197772 CCAGGGAACAGGTGGGTGACAGG + Intergenic
1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG + Intronic
1032854944 7:135826206-135826228 CCAGTGCTTAAGAGGGTGCCTGG - Intergenic
1033941321 7:146658731-146658753 CCAGTGATGAGGTAAGTGTGTGG + Intronic
1033987521 7:147244499-147244521 CCAGTGAATGGGTGGATGACTGG - Intronic
1035372240 7:158386949-158386971 CGAGTGCTTAGGTGGGTGATCGG - Intronic
1041354453 8:56985469-56985491 GGAGTGATTGGCTGGGTGTCGGG - Intronic
1042228101 8:66530602-66530624 CTGGTGTTTGGGTGGGTGTCAGG - Intergenic
1044827716 8:96214242-96214264 CCAGTGGTTAGGTAGGCGTGGGG + Intergenic
1045442664 8:102229426-102229448 CCAGTGCTTAGCACGGTGTCAGG - Intronic
1050653188 9:7795201-7795223 CCAATGATTATGTAGGTGTTAGG - Intergenic
1052519441 9:29526124-29526146 CCAGGGACTAAGTGGGTGTTGGG - Intergenic
1054579000 9:66892689-66892711 ACAGAAATTAGGTGGTTGTCAGG + Intronic
1054796571 9:69307684-69307706 ACAGTGTTCAGGTGGGTGTTTGG + Intergenic
1059182309 9:112228821-112228843 TGATTGATTGGGTGGGTGTCAGG - Intronic
1060277696 9:122194296-122194318 CCAGTGCTTAGGGGAGTGTCTGG - Intronic
1062453511 9:136625292-136625314 CCAGAGAGTGGCTGGGTGTCGGG - Intergenic
1186676499 X:11822705-11822727 CCACTGACGAGGTGAGTGTCAGG + Intergenic
1187138157 X:16568485-16568507 TAAGTGATCATGTGGGTGTCAGG - Intergenic
1188450944 X:30308084-30308106 TCAGTGATCAGGAGAGTGTCGGG - Intronic
1193073626 X:77332749-77332771 CCAGTGAGGAGGAGTGTGTCAGG + Intergenic
1196173097 X:112611478-112611500 ACAGTGAGAAGGTGGCTGTCTGG - Intergenic
1198106138 X:133463089-133463111 ACAGTGTTTAGGTGGGGGTGGGG - Intergenic
1200136924 X:153879739-153879761 CCAGGGAACAGGTGGGGGTCGGG + Intronic