ID: 1063631406

View in Genome Browser
Species Human (GRCh38)
Location 10:7737080-7737102
Sequence ATCCATTGGAATACTGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063631406_1063631412 2 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631412 10:7737105-7737127 TTTGCTTCCTGGAGGACTCTGGG No data
1063631406_1063631410 -6 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631410 10:7737097-7737119 ATGGATGTTTTGCTTCCTGGAGG No data
1063631406_1063631418 9 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631418 10:7737112-7737134 CCTGGAGGACTCTGGGGGAGGGG No data
1063631406_1063631409 -9 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631409 10:7737094-7737116 CCAATGGATGTTTTGCTTCCTGG No data
1063631406_1063631413 3 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631413 10:7737106-7737128 TTGCTTCCTGGAGGACTCTGGGG No data
1063631406_1063631411 1 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631411 10:7737104-7737126 TTTTGCTTCCTGGAGGACTCTGG No data
1063631406_1063631419 25 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631419 10:7737128-7737150 GGAGGGGAGTAGACAAGAACTGG No data
1063631406_1063631414 4 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631414 10:7737107-7737129 TGCTTCCTGGAGGACTCTGGGGG No data
1063631406_1063631415 7 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631415 10:7737110-7737132 TTCCTGGAGGACTCTGGGGGAGG No data
1063631406_1063631416 8 Left 1063631406 10:7737080-7737102 CCTACACCAGTATTCCAATGGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1063631416 10:7737111-7737133 TCCTGGAGGACTCTGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063631406 Original CRISPR ATCCATTGGAATACTGGTGT AGG (reversed) Intronic
905504419 1:38465745-38465767 ATCCATGCTAATACTGGGGTCGG - Intergenic
913117015 1:115706510-115706532 ATCCCTTGGGATAGTGGGGTTGG + Intronic
914878163 1:151527549-151527571 ATGGACTGGAATACTTGTGTTGG + Intronic
915712176 1:157910687-157910709 ATCCTTTGAAATATTGGTGGAGG - Intergenic
915875905 1:159612038-159612060 GTCCATTGGAATATAGGAGTGGG + Intergenic
920836925 1:209519766-209519788 ATCCTTTGGAATCTTGGTGGAGG - Intergenic
921400521 1:214717777-214717799 ATCTATTGCTATCCTGGTGTGGG + Intergenic
922821972 1:228490838-228490860 AGCCATTGGAGTTCTGGTGTGGG + Intronic
923557094 1:235009834-235009856 ATCAAAGGGAAGACTGGTGTTGG + Intergenic
1063631406 10:7737080-7737102 ATCCATTGGAATACTGGTGTAGG - Intronic
1065871875 10:29962778-29962800 AGTCCTTGGAATCCTGGTGTGGG - Intergenic
1069005958 10:63317689-63317711 CACCATTGGCATTCTGGTGTTGG - Intronic
1071697097 10:87887945-87887967 ATCCTTTGAAATCCTGGTGGTGG - Intronic
1073165132 10:101440810-101440832 ATGCACTGGAAAAATGGTGTTGG + Intronic
1075111781 10:119593218-119593240 ATGCTGTGTAATACTGGTGTTGG - Intronic
1075253344 10:120902934-120902956 ATCCACTGGGATACTGGCATGGG - Intronic
1077704508 11:4471624-4471646 AACCATTTGAGTGCTGGTGTAGG + Intergenic
1077732454 11:4746884-4746906 ATACATTGGAATAATGTTCTTGG + Intronic
1083246537 11:61432292-61432314 ATCCATGGGATGACTGTTGTAGG + Intronic
1084041029 11:66542849-66542871 ACCCATTGGGAAGCTGGTGTGGG + Intronic
1088198052 11:107297588-107297610 ATCTATTGAAATAATCGTGTGGG - Intergenic
1088664367 11:112079538-112079560 ACCCATGGGAATACTGGAGTAGG - Intronic
1088902248 11:114127097-114127119 ATCCAGGGGAATAGTGGAGTTGG - Intronic
1093374247 12:18404927-18404949 ATCCATTTGAAAAATGGTCTGGG + Intronic
1095402710 12:41833581-41833603 ATAATTTGAAATACTGGTGTAGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1104317669 12:127719245-127719267 AATCCTTGGAATCCTGGTGTGGG - Intergenic
1107121807 13:36804289-36804311 ATCCTTTTGAATATTTGTGTAGG - Intergenic
1123811480 15:23930816-23930838 ACAGCTTGGAATACTGGTGTAGG - Intergenic
1124581076 15:30955606-30955628 ATCCATTGGAACACTTGCCTGGG + Intronic
1126967167 15:54067524-54067546 ATGCATTTGAATACTGTTTTAGG + Intronic
1132095896 15:98984684-98984706 ATCCACTGGGATTCTGGTTTGGG - Intronic
1133497987 16:6338239-6338261 ATCAAAAGGAATACAGGTGTAGG - Intronic
1137277252 16:46943991-46944013 AGCAATTGAAATACTGGTGGTGG + Intergenic
1144855912 17:18267703-18267725 AGCAAATGGAATAGTGGTGTAGG + Intergenic
1159881729 18:73864763-73864785 ATCCATTAGAAGGCTGCTGTAGG - Intergenic
1167477097 19:49707391-49707413 ATCCATTGGGGTGCTGGTATGGG - Intronic
926610987 2:14946513-14946535 ATACTTGGGAATTCTGGTGTTGG - Intergenic
931541454 2:63334057-63334079 ATCCATTGGAATTCTGGGAGGGG + Intronic
932795480 2:74691937-74691959 AGCCATTGGAATGCTCCTGTCGG + Intergenic
936709785 2:115119359-115119381 GTCTATTGGGAGACTGGTGTTGG + Intronic
940991728 2:160104107-160104129 GTCCCTTGCAATACTGGTTTAGG + Intronic
941324699 2:164099232-164099254 ATCAATTGTAATACTGTTGCAGG - Intergenic
1170088682 20:12566344-12566366 TGCCATTGGAATACTTCTGTGGG + Intergenic
1174672823 20:52323857-52323879 ACCCATAGGAAGACTCGTGTAGG + Intergenic
1175620339 20:60440015-60440037 ATACAGTGTAACACTGGTGTAGG - Intergenic
1180348355 22:11723739-11723761 AAACATTGGTATACTGGTGAAGG - Intergenic
1182995913 22:34812405-34812427 CTCCATTGGAATAAGGATGTAGG - Intergenic
1184723220 22:46328193-46328215 CGCCATTGGAAAGCTGGTGTGGG + Intronic
953145480 3:40270830-40270852 ATCCTTTGAAATCCAGGTGTAGG + Intergenic
956159118 3:66329856-66329878 ATGCATTTTAATACTGATGTAGG + Intronic
958434161 3:94077187-94077209 AGCCAGGGGAATACTGGAGTCGG + Intronic
963888293 3:150604497-150604519 ATACATTGGAATGTTGGTGTTGG + Intronic
975267702 4:72390706-72390728 ATGCTTTGGAATACTGGTATGGG - Intronic
975404393 4:73972809-73972831 ATCTATTGGAATAATCATGTGGG - Intergenic
980683045 4:136188118-136188140 AGCCATAGGAATACTGGGTTTGG + Intergenic
980747179 4:137033923-137033945 ATGCCTTGTAATACTTGTGTAGG - Intergenic
982788426 4:159562239-159562261 ATTCATTGCAATTCTGTTGTTGG - Intergenic
984591025 4:181617829-181617851 ATCCTTTTCAATAGTGGTGTTGG - Intergenic
985823911 5:2178981-2179003 ACGCATTGCAATACTGGTCTGGG - Intergenic
996239814 5:121183088-121183110 ACCCATCGCAATACTGGGGTGGG - Intergenic
1004631843 6:17428850-17428872 ATCCCCTGGGAGACTGGTGTTGG - Intronic
1007064561 6:38976997-38977019 CTCCCTTGGAATCCTGGTTTGGG + Intronic
1007267282 6:40606240-40606262 ATACTATGGAATACTGGTATAGG - Intergenic
1010549575 6:77204656-77204678 ATTCACTGGAATACAGGGGTGGG - Intergenic
1013773921 6:113657971-113657993 TTCAGTTGGAATACAGGTGTTGG + Intergenic
1014059653 6:117056395-117056417 ATACCTTGGAACATTGGTGTGGG - Intergenic
1015847621 6:137537218-137537240 ATTCCTTGGATTACTGGTTTAGG + Intergenic
1016711525 6:147178260-147178282 AACCATTGGAATTGTGGTGCTGG - Intergenic
1017277526 6:152587321-152587343 AGCCCTTGGAATAATGGTGTAGG - Intronic
1020077863 7:5270430-5270452 ATCCATTGGAACACAGAGGTTGG - Intergenic
1023726639 7:43148977-43148999 ATCAATTGGAATTCTTCTGTAGG - Intronic
1023768328 7:43532420-43532442 ATCCATTGGAAGTTTCGTGTAGG - Intronic
1025201024 7:56961740-56961762 ATCCATTGGAACACAGAGGTTGG + Intergenic
1025670919 7:63615192-63615214 ATCCATTGGAACACAGAGGTTGG - Intergenic
1027437935 7:78185636-78185658 ATCCATTCGAAAACTGGTCCTGG + Exonic
1030800917 7:113850723-113850745 ATAAATTAGAATTCTGGTGTAGG - Intergenic
1033442694 7:141394677-141394699 ATCCACATGAACACTGGTGTTGG - Intronic
1034334264 7:150310346-150310368 ATCCCTTTAAATCCTGGTGTGGG - Intronic
1044702982 8:94981029-94981051 AACCATGGTAATACTGGGGTGGG - Intronic
1047633289 8:126731540-126731562 ATTCTTTGGGATTCTGGTGTAGG - Intergenic
1058541015 9:106012694-106012716 ACCCATTGGAATTCACGTGTGGG + Intergenic
1058605007 9:106711694-106711716 GTCCATTGAAAAACTGGTGTTGG - Intergenic
1060236316 9:121865577-121865599 TTCCATTGGATTACTGATTTGGG - Intronic
1198949080 X:142049509-142049531 AGCCATTGAAATACAGGAGTGGG - Intergenic
1199309009 X:146300746-146300768 ATCCTTTTGAATTCTTGTGTTGG + Intergenic
1200266932 X:154651541-154651563 AACAATGGGAATACAGGTGTGGG + Intergenic