ID: 1063631902

View in Genome Browser
Species Human (GRCh38)
Location 10:7741867-7741889
Sequence CTGAGTGTACAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063631902 Original CRISPR CTGAGTGTACAGAATGAGGA AGG (reversed) Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904973141 1:34434764-34434786 CTGAGTGCACACAAACAGGATGG + Intergenic
905014919 1:34771290-34771312 CTGAGTGGGCAGAATAAGTAAGG - Intronic
905270180 1:36782450-36782472 CTGAGTGCTCAGAAAGAGAAGGG + Intergenic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
906333664 1:44909280-44909302 GTGAGTTTTCAGAAAGAGGATGG - Intronic
906674391 1:47682723-47682745 CTGAGTCTAAAGAATGAGCCAGG - Intergenic
907076346 1:51582659-51582681 GTGAGTGTAGAGAAGGAGGGAGG - Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910537560 1:88316156-88316178 ATGATTGTACAGAGTGAGCAAGG + Intergenic
911445161 1:97983578-97983600 CTGAGTGTACAGTAGGTAGATGG + Intergenic
912507631 1:110167032-110167054 CAGAGTGTACTGAATGTGGCTGG + Exonic
912589561 1:110802494-110802516 CTGCTTGTCCAGAATGAGGGAGG - Intergenic
915063646 1:153207088-153207110 CTGACTGTACAGACTCAGGCTGG - Intergenic
916472402 1:165137220-165137242 CTGAGTGCCCAGAATGAGGGAGG + Intergenic
916739271 1:167634025-167634047 TTGAGTCTCCAGAATGAGCACGG + Intronic
916856051 1:168751268-168751290 CTATGTTTACTGAATGAGGAGGG - Intergenic
917274380 1:173316171-173316193 CTAAGCATACACAATGAGGAAGG - Intergenic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920811971 1:209294543-209294565 CTCAGTGGAGAGAATGAGTAGGG - Intergenic
920975422 1:210781210-210781232 CTCAGTGTACAGAGTGTGGAAGG - Intronic
922109745 1:222545519-222545541 GAGAGTGGACAGAATGAGCAAGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1065166860 10:22988604-22988626 CTGAGTGCAGTGAATGATGATGG + Intronic
1065806536 10:29398369-29398391 CTCAGAGCACAGAAGGAGGACGG - Intergenic
1066182487 10:32976867-32976889 CTGAGAGTTCAGAATGTGCAGGG + Intronic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067452383 10:46390299-46390321 GTGAGGGTACAGCAGGAGGAAGG - Intronic
1067584851 10:47469456-47469478 GTGAGGGTACAGCAGGAGGAAGG + Intronic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1068610476 10:59054733-59054755 GTGAGTGTAAAGAAAGGGGAGGG - Intergenic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1070960130 10:80492997-80493019 CTTGGTTTACAGAATGAGAATGG + Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1071837360 10:89431791-89431813 CTGAGTCTTCAGATTGAAGAGGG - Exonic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1073518113 10:104097397-104097419 TGGAGTGGACAGAATGAGGTCGG - Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1078156932 11:8807444-8807466 CGGGGTGTACAGATTCAGGAGGG - Intronic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1078935410 11:15945185-15945207 CTGAGTGTAGAGGGTAAGGAGGG + Intergenic
1079544492 11:21616199-21616221 TTGAGTTTAGCGAATGAGGAGGG - Intergenic
1079867385 11:25753577-25753599 CAGAGAGTATAGAATGATGAAGG - Intergenic
1080691330 11:34561080-34561102 TTGAGTCTAGAGAATGAGCAGGG - Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1082910008 11:58361260-58361282 CTAAGTGTAGAATATGAGGAAGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084371643 11:68749258-68749280 CTTAGTGTACAGGAAAAGGATGG - Intronic
1086445594 11:86867460-86867482 TAGAGTGTACATACTGAGGAAGG + Intronic
1087209608 11:95433361-95433383 TTGAGTGGACAGAATGTGTATGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1092847359 12:12596160-12596182 CTGAGTGAAGAGAATGAGTTAGG + Intergenic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1094179189 12:27573469-27573491 CAAAGGGTACAGAATGAGTATGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1100960625 12:99958776-99958798 CTGAGTGGACAGAAGTAGTAAGG + Intronic
1101477084 12:105061157-105061179 CTGAGTGTACAAGATGAAGAGGG - Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1105452413 13:20511856-20511878 CTGAGTGCTAAGAATGCGGAGGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1115154532 14:30322999-30323021 CTGAATGTAAATAATGAGAAGGG - Intergenic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1119236334 14:73022811-73022833 CTGGGAGTACAGAATGACTAGGG - Intronic
1119854325 14:77887933-77887955 CTAAGAGTCCAGAGTGAGGAAGG - Intronic
1119963643 14:78888339-78888361 CTGAGTATCCAGAATGAGTTTGG + Intronic
1120183479 14:81368809-81368831 CTGGGACTAGAGAATGAGGAGGG - Intronic
1120931583 14:89854403-89854425 CTTAGTATCCTGAATGAGGAGGG - Intronic
1124159161 15:27253416-27253438 CTGAGTGGACAGCTTGGGGAGGG - Intronic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1124858093 15:33410469-33410491 CTGAGTTTGAATAATGAGGATGG - Intronic
1125478698 15:40065063-40065085 CTGAGAGAACAGCATGAGCAGGG + Intergenic
1126279633 15:46929827-46929849 CTGACTTTACAGAATGAGTTAGG + Intergenic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1127280812 15:57490716-57490738 CAGAGTGTACAGGATGAAGTGGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1133589157 16:7226002-7226024 CAGAGTGTACAGATTCAGCAAGG - Intronic
1133813932 16:9182138-9182160 CTAAGTCTTCAGAAAGAGGATGG - Intergenic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134136594 16:11680462-11680484 CTGAGAGCACAGAATAAGGAAGG + Intronic
1137675867 16:50303683-50303705 CTGAGTGTCCAGCATGAGGCTGG + Intronic
1138916728 16:61473289-61473311 CTGACTTCACAGAATGAGTACGG - Intergenic
1139289500 16:65844674-65844696 AGTAGGGTACAGAATGAGGAAGG + Intergenic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1143786665 17:9260763-9260785 CTGAGTTTCCAGGGTGAGGAGGG - Intronic
1144182157 17:12762553-12762575 CTCAGGTTACAGAATGAGAAGGG + Intronic
1144228606 17:13176355-13176377 CTGAGTGGCCACAATGAGGGTGG - Intergenic
1145921989 17:28616540-28616562 CTGAGACTTCAGAACGAGGATGG - Intronic
1147283006 17:39378075-39378097 CAGACTGTACAGAATTAGGTTGG + Intronic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149041083 17:52189052-52189074 CTGAGTGTATAAAATCAGGAAGG - Intergenic
1149154878 17:53616159-53616181 CTGATTCTACAGAAGTAGGATGG + Intergenic
1149466110 17:56880430-56880452 CTCAGTGTCCAGAATGAAGTGGG - Intergenic
1152310481 17:79546971-79546993 GTGGGTCTAAAGAATGAGGAAGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1153220500 18:2856560-2856582 CTGCGTGTACATAATGAAGTAGG + Intronic
1160436527 18:78856463-78856485 CTTAGTGGAAAGAATGATGAAGG - Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164977324 19:32582896-32582918 CTGGGTCTACAGAAATAGGAAGG + Intronic
1166938174 19:46347429-46347451 CTCAGTGGAGAGACTGAGGAGGG + Intronic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
927679896 2:25132355-25132377 CTAAGAGAAAAGAATGAGGAAGG + Intronic
930579493 2:53193406-53193428 CTGAATGTAAAGCATGAAGATGG + Intergenic
930713044 2:54567212-54567234 CTTAAAGTACAGAGTGAGGATGG + Intronic
932111260 2:69003226-69003248 CTGAATGTACTGAATGCTGAAGG - Intergenic
932926414 2:75980079-75980101 CTGAGTTTACAGCCTGATGAGGG + Intergenic
933711690 2:85330969-85330991 CTGAGTGTACAGCATGTAGTAGG + Intergenic
937310854 2:120902501-120902523 CAGAGTGTGCAAAATAAGGAGGG + Intronic
937366328 2:121264509-121264531 CTGGGAGTGCAGAATCAGGAGGG + Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
939784415 2:146492424-146492446 TTCAGTGTACAAAATGAGGATGG - Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941537315 2:166739966-166739988 CTTACTTTACAGAATCAGGAAGG - Intergenic
943369993 2:187003670-187003692 CTGTGTGTAAAGACTGTGGAAGG - Intergenic
947712583 2:232324541-232324563 CTGAGTGTCCTGTGTGAGGAAGG + Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
1170477291 20:16728729-16728751 CTGAGTGTAGAGAATGTTAAGGG - Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171816021 20:29786777-29786799 CTGAGTGTTCAGCATGAGTGGGG + Intergenic
1173935585 20:46859449-46859471 CTGAGTGTGCAGCTTCAGGAGGG - Intergenic
1174582458 20:51581689-51581711 CTAAGTCTTAAGAATGAGGATGG - Intergenic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1177963895 21:27703310-27703332 TTCAGTGTACAGATAGAGGAAGG - Intergenic
1180217758 21:46336724-46336746 CTCCGTGGACAGAGTGAGGAAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184485453 22:44775971-44775993 ATGAGTGACCAGAATCAGGAAGG - Intronic
950100562 3:10354048-10354070 CAGAGGGGACAGAATGAGCAGGG - Intronic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952180052 3:30907686-30907708 CTCAGTTTACAGTATGAGCACGG + Intergenic
955044300 3:55345273-55345295 CTGAGTATACTGAAAGAGAAAGG + Intergenic
955398175 3:58572428-58572450 CTGACAGTTGAGAATGAGGAAGG + Intronic
956231221 3:67018776-67018798 CTTGGTGTTCAGAATGAAGACGG + Intergenic
957002565 3:74903080-74903102 CAGAGTATATAAAATGAGGATGG + Intergenic
957341047 3:78897135-78897157 GTGAAGGTACAGAATAAGGAGGG - Intronic
958562187 3:95760313-95760335 CTGACTTTACAGAATGAGTTAGG - Intergenic
959080631 3:101797166-101797188 CTCAGAGTAAAGAATGGGGAGGG - Intronic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959708008 3:109357310-109357332 CTGAGGTTACAGAAAGAAGAGGG - Intergenic
960092686 3:113657526-113657548 CTGAGTTTGAAGAATTAGGAGGG + Exonic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962664957 3:137644615-137644637 ATGAATGTAGAGAATGGGGAGGG - Intergenic
963202602 3:142600209-142600231 TTGAGTGTACACAGTGAGGAGGG + Intronic
965804570 3:172528848-172528870 CTGAGCTTCCAGAATGAAGAGGG + Intergenic
966268696 3:178079152-178079174 CTGAATGAACAGGATTAGGATGG + Intergenic
966508781 3:180736951-180736973 CTGAGATTCCAGAATGAGGCAGG + Intronic
970707370 4:18821438-18821460 CTGGCTGTACAGAATGAGTTTGG - Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
978197691 4:105990317-105990339 ATGAGAGTTCAGAATGGGGAAGG + Intronic
979834739 4:125350770-125350792 CTTACTGTAGAGAATGAGGAGGG - Intronic
980718807 4:136665402-136665424 CTGATAGTACAGAATGAGTTAGG - Intergenic
981954835 4:150457784-150457806 CTGGGTGTACAAACTGAGGTAGG - Intronic
984682614 4:182627288-182627310 CTTAATGTATAAAATGAGGATGG - Intronic
985162583 4:187060113-187060135 CTGAGGCTACAGACTGAGGGAGG - Intergenic
986373777 5:7109309-7109331 CTCAGTGTACTGAATTAGGATGG + Intergenic
986959337 5:13194089-13194111 TAGAGTGTACAGTATGAGAATGG - Intergenic
988271996 5:29028969-29028991 CTGAAGGTAGAGAATGGGGAGGG + Intergenic
988273714 5:29053090-29053112 CAGAGTTTACAGAATAAGTATGG - Intergenic
988821233 5:34888140-34888162 GTGAGTTTACAGAAAGAAGATGG + Intronic
989062377 5:37422080-37422102 CTGAGGGTAAAGGATAAGGATGG + Intronic
991113465 5:62927603-62927625 CTGAGTCTAAAGCTTGAGGATGG + Intergenic
993909307 5:93661905-93661927 CTGAGTGGGCAGAAAGAGTAAGG + Intronic
994572627 5:101533581-101533603 CTGAATGTACAGAATAAGAAAGG - Intergenic
994751697 5:103746012-103746034 CTGAGTGTAGAGAAATAGTATGG - Intergenic
996741088 5:126799588-126799610 CTGAGGGTCCAGAAGAAGGAAGG + Intronic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
999650771 5:153765260-153765282 CTAAGTGTACAGAACAAGTAAGG - Intronic
999948152 5:156619728-156619750 CTCAGTGCACAGAATAGGGAAGG + Intronic
1001295172 5:170494100-170494122 CTGAGTGAGGAGACTGAGGAAGG - Intronic
1001835152 5:174825299-174825321 CTGAGTCTAGAGAATGGGAAAGG - Intergenic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1004375222 6:15085300-15085322 CTGATTTTGAAGAATGAGGAAGG - Intergenic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1008148465 6:47920908-47920930 CTGAGATTATAGAAAGAGGAAGG + Intronic
1010929633 6:81785626-81785648 GTGGGTGTACATAATGAGGGTGG - Intergenic
1012007748 6:93735651-93735673 ATGAGTATATAGAATGAGTAGGG - Intergenic
1012945322 6:105459859-105459881 CTGAGTGACCAGAATGATGAAGG - Intergenic
1013218641 6:108055686-108055708 CTGAGAGTACAGAAAGTAGATGG - Intronic
1014140954 6:117941349-117941371 ATGAATGTACACAATGTGGAAGG - Intronic
1014563706 6:122922162-122922184 CTGAGTGCACACAATGAGTGAGG + Intergenic
1016262121 6:142184718-142184740 CTGAGTGTCCACAATGTAGAGGG + Intronic
1016279494 6:142399150-142399172 CTGAGTGTAGAGAAGGCGAAGGG - Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018395735 6:163376816-163376838 CCGAGTGTATTGAATGAAGATGG - Intergenic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1021965959 7:25918488-25918510 CTTATTGTACTGAATCAGGAAGG + Intergenic
1022746523 7:33178381-33178403 CTGAGTGGACACAATGAAGGTGG - Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1024140450 7:46457916-46457938 CTGAGGTTACAGAAAGAAGAGGG + Intergenic
1024812722 7:53232894-53232916 CTGAGTGTAAATAGTGAGCAGGG - Intergenic
1024813281 7:53238157-53238179 CTCAGTGTACAGCAAGCGGAAGG + Intergenic
1027580066 7:79981688-79981710 CTTAATGTACATACTGAGGAAGG + Intergenic
1027751195 7:82149076-82149098 CTGAGTACACAGACTGAGGCAGG - Intronic
1028358934 7:89944309-89944331 CTTAGTCTACAGAAAGAGGTAGG - Intergenic
1030154789 7:106443314-106443336 CAGAGACTACAGTATGAGGAAGG + Intergenic
1033449287 7:141448627-141448649 CTCAGTGTCCAGACTGAGGGTGG + Intronic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1036962573 8:13261340-13261362 CAGAGTGTATAGAATGGGAAAGG + Intronic
1037034495 8:14148675-14148697 CTGATTGTATAGAATGAGTTTGG - Intronic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1040463981 8:47677620-47677642 CTGAGTGTTGAGAATGACAAAGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040994004 8:53382722-53382744 TTAAGTGTCAAGAATGAGGAAGG - Intergenic
1041740998 8:61156305-61156327 CTGAGGTTACAGAATGAATAGGG - Intronic
1042924591 8:73954169-73954191 CTGAGGGTAGAGAATGGGAAGGG + Intronic
1043255374 8:78130116-78130138 CTGAGTGTTCACAATGTGCAAGG + Intergenic
1043459663 8:80446626-80446648 ATGAGTGGGCAGAATGAGCAGGG + Intergenic
1044482678 8:92711114-92711136 CTGAGTGGACAGTGTTAGGAAGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1045475591 8:102549757-102549779 TTTAGTGAACAGAGTGAGGATGG - Intergenic
1047900068 8:129411014-129411036 GAGAGTGTAAAGAATGAAGAGGG + Intergenic
1048661520 8:136608162-136608184 CTGAGTTTTAGGAATGAGGAAGG - Intergenic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1051192486 9:14529966-14529988 CTGACTGTACAGAAGTAGAATGG + Intergenic
1052268601 9:26603222-26603244 CAGAGTGTACACAATGAAGTGGG - Intergenic
1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054750514 9:68900334-68900356 CTGAGTGTATAGAATAAGCCAGG - Intronic
1055161821 9:73139077-73139099 CTGAGGGTACAGAATGGGAAGGG + Intergenic
1055360560 9:75485470-75485492 CTGAGTGGAAGAAATGAGGATGG + Intergenic
1055535470 9:77238555-77238577 CTGAGTGTAAAAAATGATTATGG - Intronic
1057862454 9:98652285-98652307 CTGAGAGTGCAGAATGGGGCTGG - Intronic
1059659300 9:116385735-116385757 CTGAGGGTGCAGAATGCAGATGG + Intronic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1062035972 9:134382684-134382706 CTGAGTGGGCAGTATGAGGGTGG + Intronic
1186372279 X:8959461-8959483 CTGAGTGCATCGAATGAGGTGGG + Intergenic
1186607663 X:11108963-11108985 GTGAGAGAACAGAATGATGAGGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1188627589 X:32305749-32305771 GTGAGTGTCCAGATTGTGGAGGG - Intronic
1191717405 X:64203265-64203287 TTGAGTGTGCCTAATGAGGATGG - Intronic
1192219183 X:69185493-69185515 GAGAGTGTATAGAATGAGAAGGG - Intergenic
1192341298 X:70265717-70265739 CCGGGTGTACAGAATGAGGGTGG + Intergenic
1192544135 X:71998713-71998735 CTGAGAGTGCAGAAAGATGAAGG - Intergenic
1192586007 X:72318668-72318690 ATGAGTGTAGAGAAGCAGGAAGG - Intergenic
1195515257 X:105767120-105767142 TTGAGTGTACAGAATTAAAAGGG + Exonic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196003754 X:110813658-110813680 CGGAGTGTATACAATGAGGGTGG + Intergenic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1196636813 X:118011626-118011648 CTGAGTGTGAAGGATGAGAAAGG + Intronic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1198828582 X:140724780-140724802 CTGTGTGTATGGAATGAGTATGG - Intergenic
1198928695 X:141828050-141828072 CTAAGGGTAGAGAATGAAGAAGG - Intergenic
1200419824 Y:2952861-2952883 CTGAGGGGAGAGAATGGGGAGGG + Intronic
1201492488 Y:14557418-14557440 CTGAGTTTACAGAAAGAGTGGGG + Intronic