ID: 1063633668

View in Genome Browser
Species Human (GRCh38)
Location 10:7759472-7759494
Sequence TGGCATAGTAAAGTTAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063633668_1063633673 3 Left 1063633668 10:7759472-7759494 CCCCCACTAACTTTACTATGCCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1063633673 10:7759498-7759520 TGAGTTTTATATTCGATATGAGG No data
1063633668_1063633676 13 Left 1063633668 10:7759472-7759494 CCCCCACTAACTTTACTATGCCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1063633676 10:7759508-7759530 ATTCGATATGAGGGGAAAAAAGG No data
1063633668_1063633674 4 Left 1063633668 10:7759472-7759494 CCCCCACTAACTTTACTATGCCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1063633674 10:7759499-7759521 GAGTTTTATATTCGATATGAGGG No data
1063633668_1063633675 5 Left 1063633668 10:7759472-7759494 CCCCCACTAACTTTACTATGCCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1063633675 10:7759500-7759522 AGTTTTATATTCGATATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063633668 Original CRISPR TGGCATAGTAAAGTTAGTGG GGG (reversed) Intronic
901242391 1:7703252-7703274 TTGCATAGCAAAGGTGGTGGGGG + Intronic
903751394 1:25623431-25623453 TTTCACAGTATAGTTAGTGGTGG + Intronic
904664795 1:32111769-32111791 TGGCATAGTAGAAATAGTGTAGG - Intronic
904938208 1:34146781-34146803 TGGGAGAGTAAAGTTTCTGGGGG + Intronic
906225042 1:44114629-44114651 TGGCATATTAAAGTGGGCGGTGG + Intergenic
906444170 1:45879596-45879618 TTGCCTACTAAAGTTATTGGTGG - Intronic
907908881 1:58809946-58809968 TGGCATTTTAAAGTTATTGGTGG + Intergenic
915448951 1:155991216-155991238 TGTCTCAGTAAAGTGAGTGGTGG - Intronic
916419930 1:164627483-164627505 TGGCATGGTAGAGTCAGAGGTGG + Intronic
917528818 1:175814666-175814688 TGGGAGGGTAAAGTAAGTGGTGG - Intergenic
923888648 1:238186308-238186330 AGGCTTAGTAAAGTTAATGTTGG + Intergenic
1063062182 10:2567589-2567611 AGGCATACTAAAGTGAATGGTGG + Intergenic
1063633668 10:7759472-7759494 TGGCATAGTAAAGTTAGTGGGGG - Intronic
1070492192 10:76987921-76987943 TAGAATACTAAAGTTGGTGGTGG + Intronic
1071429488 10:85595436-85595458 TGGAATAGTAAACACAGTGGTGG + Intergenic
1071430915 10:85606005-85606027 TGGAATAGTAAACGTGGTGGTGG + Intronic
1073388508 10:103150051-103150073 TACCTTAGTAAAGTTGGTGGAGG - Intronic
1075868317 10:125747624-125747646 TGCCATAGTAAAGTAAGTAGTGG - Exonic
1083412363 11:62503122-62503144 TGTCAGAGTAGAGTGAGTGGGGG + Intronic
1083783812 11:64932536-64932558 TGGCATAGTAGAGTCTGTAGTGG + Intronic
1088156062 11:106805202-106805224 TGTCAGAGTAAAGGTAGAGGGGG - Intronic
1088864912 11:113838452-113838474 TGGGATAGGAAAGGTGGTGGAGG - Intronic
1098146372 12:67501828-67501850 TATCATAATAAAGTTAGTTGTGG + Intergenic
1105723333 13:23137470-23137492 TGGCATAGTATAGTTAGCAAAGG + Intergenic
1106735398 13:32583902-32583924 TGACAAAGTAAAATTAGTAGAGG + Intergenic
1108829391 13:54458626-54458648 TGGTAAAATAAAATTAGTGGTGG - Intergenic
1109064992 13:57675597-57675619 TGGCAGAGTAAAGTCAGAGGAGG + Intronic
1112558184 13:100488471-100488493 TAGCATTTTAAAGTTAGTGGAGG + Intronic
1113222446 13:108120515-108120537 TTGCATATTAAAGTTAGGGTGGG + Intergenic
1114326596 14:21595221-21595243 TGGCATTGTAAAATGAGTTGGGG - Intergenic
1115527736 14:34298379-34298401 TGGCTTCGTAATGTTACTGGCGG - Intronic
1120970010 14:90199350-90199372 TAGCATACTACTGTTAGTGGTGG - Intergenic
1126004103 15:44240201-44240223 TGGCAAAGGAAATGTAGTGGTGG + Intergenic
1127928024 15:63567070-63567092 TGTCATAGTTAAGTATGTGGTGG + Intronic
1128274678 15:66343061-66343083 TGACATTGTAAAGTCAGTGGGGG - Intronic
1128714378 15:69896707-69896729 TTGCATAGTAAAGAGAGGGGAGG - Intergenic
1130395434 15:83496997-83497019 AGACATAGGAAAGATAGTGGAGG - Intronic
1133447188 16:5871805-5871827 TGGCAATGTAAACTCAGTGGAGG + Intergenic
1140430582 16:74899442-74899464 TGGCAAAGGAAAGTTAATGCTGG - Intronic
1141322859 16:83028043-83028065 AGGCATATGAAAGTTTGTGGGGG - Intronic
1143273403 17:5692336-5692358 TGGCATAATAAAGTGAGAGGAGG + Intergenic
1147114293 17:38287428-38287450 TGGCATAATGAAATTCGTGGGGG - Intergenic
1148415315 17:47501762-47501784 TGGCATAATGAAATTCGTGGGGG + Intergenic
1153410714 18:4789517-4789539 TGGCAAAGTAATGTGGGTGGGGG - Intergenic
1153731926 18:8022622-8022644 TTGCCTTGTAAAGTTAGTGATGG + Intronic
1156872291 18:41959906-41959928 TGCCATCCTAAAGTGAGTGGAGG + Intronic
1158612038 18:58949864-58949886 AGGCAAGGTAAAGATAGTGGTGG + Intronic
1159127110 18:64236565-64236587 TGGCATAATATAGATAGAGGAGG - Intergenic
925887346 2:8404197-8404219 TGCCATGGAAAAGATAGTGGAGG - Intergenic
927392491 2:22611019-22611041 TGGGATAGTACTGTTAGTGTTGG + Intergenic
930300555 2:49610446-49610468 GGACATAGTAAAGTTAGAGCTGG + Intergenic
940660101 2:156534981-156535003 TGGCCAGGTAAAGTCAGTGGGGG + Intronic
940972541 2:159909319-159909341 TGGCATTGTAAAATTTTTGGTGG + Intergenic
942217965 2:173740888-173740910 TGGCAAAGTAGAGTTACCGGTGG + Intergenic
944622367 2:201529635-201529657 TGGAATTGTAAAGTTAATAGAGG + Intronic
945946546 2:216000888-216000910 TGGCTTAGTAAAGTAAAAGGTGG - Intronic
1169357731 20:4922152-4922174 AGGCAAATAAAAGTTAGTGGGGG + Intronic
1173649489 20:44653814-44653836 GGGCATAGTGATGTCAGTGGGGG + Intergenic
1174091879 20:48055662-48055684 GGGCTTGATAAAGTTAGTGGTGG - Intergenic
1177925017 21:27203337-27203359 TGGCATGGTACAGTTAGGTGTGG - Intergenic
1178112796 21:29385914-29385936 TGGCATAGGACAGATAGAGGAGG - Intronic
951058313 3:18173624-18173646 TGGTTTAGTAAAGTGACTGGAGG - Intronic
954831657 3:53426216-53426238 TGGCTTAGGGATGTTAGTGGTGG - Intergenic
955324757 3:58001384-58001406 TGTAATAGTAAAAGTAGTGGTGG - Intergenic
955948152 3:64214935-64214957 TAGGATAGTAAAGATAGAGGTGG - Intronic
964954363 3:162334388-162334410 TGCTTTAGTAAAGTTACTGGAGG + Intergenic
966663318 3:182440650-182440672 TCTCATAGTAAAATTAGTGATGG + Intergenic
967258747 3:187620833-187620855 TGGCATAGTAAGGAATGTGGAGG + Intergenic
969574516 4:8029225-8029247 TGGGAAAGCAAAGTCAGTGGTGG - Intronic
971159437 4:24118813-24118835 TTGCATAGAAAATTAAGTGGAGG + Intergenic
976412165 4:84727447-84727469 TGGGATGGTAAAGGTAGTGAAGG - Intronic
981388633 4:144161304-144161326 TGGCCTTGTAGAGTTAGTTGGGG + Intergenic
982270745 4:153584559-153584581 TGGCAGAGTAAAATGTGTGGAGG - Intronic
982671686 4:158327698-158327720 TTGCATAATAAAGTTAGGGTGGG + Intronic
984172052 4:176370815-176370837 TGGTAAAGTCAAGTTAGTGAAGG - Intergenic
984535884 4:180974651-180974673 TGGTATAGTAATATTAGTAGTGG + Intergenic
995747558 5:115419373-115419395 TGGTATAGTAAAGGTATTAGTGG - Intergenic
996138500 5:119874588-119874610 TGGTAGAGAAATGTTAGTGGTGG - Intergenic
996586544 5:125094146-125094168 TGTCATAATAATGTTAGAGGAGG + Intergenic
998847194 5:146322617-146322639 TGGCATATTAAAGCTGGAGGGGG + Intronic
1000352081 5:160359951-160359973 TGGCCTAGAAAAGGTAGGGGGGG - Intronic
1003817411 6:9857598-9857620 TGGCATAATAAAGCCTGTGGAGG - Intronic
1004722344 6:18277979-18278001 TAGGATAGTAAAGGAAGTGGGGG - Intergenic
1012536567 6:100305548-100305570 CAGCATATTAAATTTAGTGGGGG - Intergenic
1014472023 6:121827789-121827811 TGGCATAATAACGTTAGAGATGG + Intergenic
1020341927 7:7120875-7120897 TGGCAAAGTCAGCTTAGTGGTGG + Intergenic
1022824861 7:33998568-33998590 TGGATTTGTAAAGTTAGAGGAGG - Intronic
1023691133 7:42789002-42789024 TGGCATAATAAAGTAAATGGAGG + Intergenic
1029104336 7:98163242-98163264 TGGAATTGTAAAGTTAGACGTGG + Intronic
1031108083 7:117570264-117570286 TGGCACGTGAAAGTTAGTGGAGG - Intronic
1031175815 7:118348175-118348197 TGTCATAGTAAAGTTATAGTGGG + Intergenic
1032592596 7:133205948-133205970 TGGTAGAGTATAGTTAGTGGTGG + Intergenic
1033894297 7:146052901-146052923 TGGCATGTTAAAGGAAGTGGTGG + Intergenic
1036186410 8:6626207-6626229 TGGCATAGAACAGGGAGTGGAGG + Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1043166438 8:76908693-76908715 AGGCATAGTAATGTAAGTGATGG - Intergenic
1044865880 8:96570859-96570881 TGGAATAGTCAAGTTCATGGAGG + Intronic
1045854887 8:106753380-106753402 TGGCAAAATGAAGTTAGTCGTGG + Intergenic
1048248759 8:132839571-132839593 TGGAATACTAAAGTAAGTGAAGG + Exonic
1055136464 9:72834745-72834767 TGCCAGATTAAAGGTAGTGGGGG + Intronic
1185674268 X:1836067-1836089 TGGCAGTCCAAAGTTAGTGGGGG - Intergenic
1186803036 X:13112653-13112675 TGGCAAAAAAAAGTTGGTGGGGG + Intergenic
1187546574 X:20259818-20259840 TGGCATAATCAAGTAAGTTGGGG - Intronic
1193120235 X:77815594-77815616 TGCCACACTAAAGTTGGTGGGGG + Intergenic
1195646130 X:107232605-107232627 GGGCATACTAGAGTTGGTGGTGG + Intronic
1198519921 X:137442149-137442171 TGGAATAATAAAATCAGTGGTGG - Intergenic
1199604227 X:149563788-149563810 GTGGATAGTAGAGTTAGTGGTGG + Intergenic