ID: 1063634921

View in Genome Browser
Species Human (GRCh38)
Location 10:7772995-7773017
Sequence TCTTGTAAGAGCAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063634913_1063634921 18 Left 1063634913 10:7772954-7772976 CCTGGATTATCAAGGTGGACCCT 0: 1
1: 5
2: 82
3: 417
4: 1012
Right 1063634921 10:7772995-7773017 TCTTGTAAGAGCAAGGTGGAGGG No data
1063634914_1063634921 -1 Left 1063634914 10:7772973-7772995 CCCTAACTACAATCATCCCTTTT 0: 1
1: 0
2: 2
3: 14
4: 206
Right 1063634921 10:7772995-7773017 TCTTGTAAGAGCAAGGTGGAGGG No data
1063634915_1063634921 -2 Left 1063634915 10:7772974-7772996 CCTAACTACAATCATCCCTTTTC 0: 1
1: 0
2: 1
3: 22
4: 237
Right 1063634921 10:7772995-7773017 TCTTGTAAGAGCAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063634921 Original CRISPR TCTTGTAAGAGCAAGGTGGA GGG Intronic
No off target data available for this crispr